Mushrooms of Nebraska

Oct 11, 2023 Field Characteristics:

• Growing locally abundant on American Hophornbeam tree in mixed oak/hickory woodland
• Sporocarps disc-shaped, slightly concaved, and light tan with a lighter ( almost white) margin.
• Spore Print: white

The Yellow Honey Mushroom (Armillaria mellea) is a decomposer and tree parasite that can be found growing in large clusters in wooded areas at the base of trees and fallen logs in the fall. It is widely distributed in the Northern Hemisphere.

This mushroom grows in large clusters at the base of trees and fallen wood. The cap shape is evenly rounded becoming flat with age. The cap is ornamented with brownish scales that are especially abundant towards the center. The scales can wear off with age.

The gill color is whitish. The gills are attached to the stem usually with a small tooth running down the stem.

The stem color starts out a golden yellowish when young generally turning whitish or brownish with age. There is a membranous ring (annulus) on the stem. The shape of the base of the stem is usually pointed due to the mushrooms growing in clusters. The spore print is white.

In addition to the mushroom, Armillaria mellea grows a network black rope-like structures of mycelium (rhizomorphs) that spread through the forest and are parasitic on trees.

September 19th, 2022 Field Notes - Indian Cave State Park

Growing at the base of dead northern red oak tree on open oak woodland ridge.

October 11, 2023 Field Characteristics:

• Primordial specimens growing at the base of hardwood tree in mixed oak/hickory woodland.
• Caps round, firm with yellow scaber-like structures on pileipellis.
• Stipes yellow and firm.

May 17, 2023 Field Characteristics:

Growing on the logs of a large hardwood tree in a large moist oak/hickory woodland draw.

The Earpick Fungus (Auriscalpium vulgare) is distinctive mushroom can be found growing alone or in small groups on buried pine cones and in the spring, fall, and winter. It is widely distributed throughout North America. It is brownish-red, distinctively kidney-shaped from the top, with a stem attached to the side of the cap, and with white spines underneath. The spore print is white

June 18th, 2024 Field Notes - Niobrara Valley Preserve:

• Growing on Ponderosa pine cone on the upper slope of spring-branch canyon.

The White Honey Mushroom (Armillaria gallica) is a decomposer of wood and can be found in the fall. It has a widespread distribution in Eastern Nebraska from Indian Cave State Park to the Niobrara Valley Preserve (Mee-Sook & Klopfenstein, 2011). A. gallica can be found in areas of dead trees decomposing wood and buried roots and is common in wooded areas and occasional lawns (decomposing tree roots).

The cap is ornamented with distinct scaly hairs that are more abundant toward the center of the stem as the mushroom matures.

The gill color is whitish. The gills are attached to the stem and sometimes have a short bit that runs down the stem (decurrent tooth).

This species has a high degree of color variation. The specimen below has a whiter base color with darker cap scales than the one above.

Fruiting bodies grow alone or in small clusters. The stem shape has an enlarged base (bulbous). It has a ring (annulus) that is cobwebby to membranous in composition. It does not have a cup at the base (volva). The spore print is white.

October 24th, 2023 Field Notes - Indian Cave State Park

468

Observed At: Tuesday, October 24, 2023 10:31 AM Created At: Tuesday, October 24, 2023 10:31 AM Last Modified At: Tuesday, October 24, 2023 11:07 AM locations: 40.254601173049124 -95.55665001723096 Form Group: Smell: pencil eraser Form Group: agaric Substrate: Substrate: terrestrial, lignicolous Growth Habit: Growth Habit: gregarious Habitat: Habitat: ( Growth Habit: gregarious, Substrate: terrestrial, lignicolous, Associated Trees: ( Carya cordiformis ) ) Associated Trees: Associated Trees: ( Carya cordiformis ) Cap: Pileus: ( Shape: ( Top view: orbicular; Profile: convex to plane to umbo to broadly umbonate ); Surface: ( texture: squamose [1]; moisture: dry-silky; color: cinnamon to pinkish buff to buff to curry-yellow to clay-pink to peach to salmon to flesh-pink [2]; koh color: brownish red [3] ) ) Shape: Shape: ( Top view: orbicular; Profile: convex to plane to umbo to broadly umbonate ) Surface: Surface: ( texture: squamose [4]; moisture: dry-silky; color: cinnamon to pinkish buff to buff to curry-yellow to clay-pink to peach to salmon to flesh-pink [5]; koh color: brownish red [6] ) Gills: Lamellae: ( Attachment: uncinate to adnate [7] ) Stem: Stipe: ( shape: clavate to terete to compressed; surface: fibrous; flexibility: firm; interior: solid to stuffed with pith ) Annulus: Annulus: ( Shape: subperonate ) Footnotes: [1] White to brown scales [2] Curry yellow bruising at the base [3] Turning reddish brown at yellow stem base [4] White to brown scales [5] Curry yellow bruising at the base [6] Turning reddish brown at yellow stem base [7] Sinuate

Spore Print: white

Field Characteristics:

480

Observed At: Tuesday, October 24, 2023 2:50 PM Created At: Tuesday, October 24, 2023 2:49 PM Last Modified At: Tuesday, October 24, 2023 2:54 PM locations: 40.260730859128394 -95.55750996386556 Form Group: Form Group: agaric Substrate: Substrate: terrestrial Growth Habit: Growth Habit: connate Habitat: In low draw adjacent to creek in oak hickory woodland Cap: Pileus: ( Shape: ( Top view: orbicular; Profile: plane to broadly convex to convex ) ) Shape: Shape: ( Top view: orbicular; Profile: plane to broadly convex to convex ) Stem: Stipe: ( interior: stuffed with pith [1] ) Annulus: Annulus: ( Texture: membranous to fibrillose ) Footnotes: [1] Inner pith as cottony threads.

The American Tree Ear is a decomposer of dead broadleaf wood and can be found in the spring through fall. It is a common mushroom that is widely distributed in North America (and possibly further).

The fruiting body takes the form a jelly-like structure. The shape is "ear"-shaped, fan-shaped, cup-shaped, and variations in-between. The color is brownish to reddish-brown becoming darker colors as it dries out. The spore print is white.

A good time to search for this mushroom are after a period of consistent, heavy rains.

May 16th, 2023 Field Notes - Indian Cave State Park

Growing on fallen Shagbark Hickory limb in large oak/hickory woodland draw.

• Exidia glandulosa growing in close proximity on the same substrate.

The Smoky Polypore can be distinguished by its gray-to-black pore surface in contrast to its pale cap surface. It is widespread across the continent and can be found year-round. It grows in large, shelving clusters on wood that stack on top of each other at the same time growing as a crust (effused-reflexed). The specimens pictured here are relatively young.

October 24, 2023 Field Notes

• Effused-reflexed.
• Nonfertile surface white to buff yellow.
• Hymenophore grayish. Smell strong and pleasant. “Bringing fond memories of from the pool as a kid”-Chance “It’s not the chlorine, it’s the fresh, “watery” smell”

Field Characteristics:

#171

-Growing gregariously from soil in open mixed oak woodland with a few Ash trees in close proximity.

-Hymenium and inner flesh instantly bruising blue, later fading back close to original color.

-Younger caps with tomentose pileipellis while older specimens matte to shiny.

-Taste: earthy, similar to dirt. Smell: not distinctive.

The Atkinson's Bolete is a soft, fleshy mushroom with a separatable pore surface on the underside of its cap. The cap top surface is brownish and the flesh of the cap is white. The pore surface begins white color and later becomes yellow. It has a net-like pattern on its stem, which is indicative of the genus Boletus. It is associated with broadleaf trees east of the Rocky Mountains. Interestingly, it has a pinkish-to-purpleish reaction when ammonia is applied to the cap surface.

June 14th, 2023 Field Notes

Growing gregariously from soil on open oak/hickory woodland ridge near American Hophornbeam, Chinkapin oak, Black Oak, and ash. Ammonia flashes pinkish instantly around the area of contact. Portions of the cap (margin) and stipe slowly staining pinkish when handled. White pore surface, tan-brown cap.

August 2019 Field Notes

Found growing amongst red oak, chinkapin oak and ironwood trees.

Short and stout boletes with cream-white pore surface and prominent reticulation down the thick stem. Flesh unchanging when cut/bruised. Ammonia on the cap resulted in a spreading pink reaction.

Field Characteristics:

• Growing as rosette at the base of large Northern Red Oak in low mixed oak/hickory woodland slope, just above riparian area.
• Large fruiting body consisting of broad overlapping fronds, tan in the middle and whitish near the margins.
• Hymenium consisting of white irregular/angular (some maze-like) pores, becoming faint near areas of fresh growth.
• Smell: fragrant like banana or pawpaw fruit.
• Taste: not distinctive.
• Spore Print: white

The Club-like Tuning Fork is a decomposer that grows on wood. This specimen was found fruiting in the cracks of a chared Black Oak trunk. It is yellow to orange-colored and is tough and gelatinous (the same features are shared with many other Dacrymycetes). It can be found fruiting on Oaks and other broadleaf woods in the spring and fall.

Calocera furcata is similar, but fruits on conifer wood.

August 3rd, 2023 Field Notes

• Growing in large numbers from lateral cracks on a charred Black Oak trunk in open mixed oak woodland.
• Fruiting bodies are orange, gelatinous but fairly tough, spire-like with a fork near the tip.
• Smell: not distinctive
• Taste: not distinctive

The Chicago Chanterelle (Cantharellus chicagoensis) is a mycorrhizal mushroom that can be found in Oak-dominated forests (though possibly associating with other broadleaf trees). It can be found across north central North America from July - September. This mushroom was once grouped into a different species called the Golden Chanterelle (Cantharellus cibarius) until DNA testing distinguished it to be a separate species (Leacock, et al., 2016).

The cap, fertile surface (hymenium), and stem are all yellow, though often greenish-yellow hues can be present when immature. This mushroom is not composed of true gills. Instead, the spore producing surface is constructed by wavy, forking ridges that run down the stem (decurrent). These ridges aren't easily separable from the mushroom which would be more typical of true "gills".

The Chicago Chanterelle grows from the soil and associates with Oak and other hardwoods. The featured specimen was found growing amidst a population of Chinkapin Oak, Elm, Northern Red Oak, Black Walnut, and Bur Oak. The smell and taste are faint to unnoticeable.

July 6th, 2023 Field Notes - Indian Cave State Park:

Growing gregariously (some fused) in mixed oak/hickory woodland.

Associated trees: Chinkapin oak, Elm, Northern Red Oak, Black Walnut, and Bur Oak.

• Smell: faintly floral
• Taste: not distinctive.

DNA Barcode ITS: GAACGCAAACGGCACCCTTCCAGTCCATTCCAAAGCGGTGGCGGAGGATGAAGACAAGGGTATCTCTGGCTGAGGGTAATGTAAACTGATCCGGTCGTACCACTGGTTGACTGGGGATTGGGCTCGCTTGGAGCGATATCGCTCTGGCTTGCCTTAAAATCAAGCGTTGTGTGGATTGGACTTTCAAGCGTGCATTGGGGACGCAGGCTCTGCGCTATATGGCAAGCCCTTGACCGTCATAGGTGCTTTGATTGGGGTCTTCAGTCTAGCCAACAAGGCTGGGTTGGACTTTGGGGCTGCATTGGGGGCGTAGGGCAGCTCTGTTCGTGGCGTCCGATGACCGTCATGGTGCATGATTGGACTTCAACTAGCAATTATTATCATTATCATTACTATGGGTTTACCTCAGGTCAGAGAAGACTACCCGCTGGACTTAA

Field Characteristics:

482

Nickname: Cerena unicolor
Sequence Number: #0482
Observed At: Thursday, October 26, 2023 10:11 AM
Location: 40.26033670408027, -95.56689605061773

Form Group: Polypore [1]

Habitat:

• Growth Habit: Single
• Substrate: Lignicolous
• Tree: [2]

Attachment: Sessile

Pileus:

• Surface:
  • Texture: Hirsute

[1] Smell pleasant

[2] Growing from the base of Elm

Collybiopsis biformis is small a decomposer that can be found growing on leaf/forest duff and dead wood east of the Rocky Mountains from summer through fall.

June 29th, 2023 Field Notes

• Growing solo on Northern Red Oak acorn shell in low mixed oak/hickory woodland.
• Compare to Gymnopus. Clitocyboid. Gills close and decurrent. Line margin. Hairy mycelium at the base of the stipe shortening in length to absent at the cap intersection. Depressed cap. Cap surface smooth with radial streaking. Growing from Northern red oak acorn shell.
• Smell: faint.
• Taste: slightly bitter.
• KOH: olive on pileipellis.

Coltricia species can be found in forested soil along woodland trails during the summer. The species collected for this study is an undescribed North American species going under the cryptic name Coltricia sp-IN01. It has a circular shape in outline (from the top down) and is navel-shaped, sunken in the center, or somewhat funnel shaped. The flesh is quite thin and flexible. The pore-shaped to tooth-shaped reproductive surface on the bottom of the cap provide a unique distinguishing feature along with its central stem and terrestrial habit.

Stay tuned for more details once it gets described.

August 15th, 2023 Field Notes - Indian Cave State Park:

Growing gregariously from soil in open mixed oak/hickory woodland.

Nearby Trees: American Hophornbeam, Northern Red Oak, Bitternut Hickory, Bur Oak, Shagbark Hickory, and Black Walnut.

• Caps orange, fibrous, iridescent with concentric light bands, with a slight central depression and a fringed margin.
• Hymenium consisting of dark brown, irregular-shaped pores and a darker sterile margin.
• Stipe dark brown, subtomentose and tapering to a slightly bulbus base.

Additional Info

• Smell: not distinctive
• Taste: not distinctive
• KOH instantly black on all surfaces but stipe which turned a darker shade of brown.

August 16th, 2023 Field Notes - Indian Cave State Park:

Growing gregariously on soil in open (but well shaded) mixed oak/hickory woodland. North-facing slope.

• Pileipellis: iridescent, hirsute at center, enrolled margin which is violet
• Hyminum: irregular pores with diff growing through; bruising dark red
• Stipe: subtomentose.
• Smell: strong

Field Characteristics:

• Growing gregariously on woodland floor in open mixed oak/hickory woodland edge.
• Flesh thin and fairly tough.
• Smell: not distinctive.
• Taste: mildly bitter.

Field Characteristics:

#218

-Growing in troops (locally abundant) on charred portion of fallen oak tree in open mixed oak/hickory woodland.

Smell: Not distinctive Taste: Bitter

Field Characteristics:

489

Nickname: Dacrypinax elegans
Sequence Number: #0489
Observed At: Thursday, October 26, 2023 1:48 PM
Location: 40.245803401857664, -95.53598855134709

Form Group: Dacrymycetales

Habitat:

• Growth Habit: Gregarious
• Substrate: Lignicolous
• Tree: Desciduous

Spores:

• Print color: [1]

[1] Light yellow

The Dirty Bolete (Cyanoboletus cyaneitinctus) is a mycorrhizal mushroom that can be found growing in woodland soil and lawns adjacent to Oaks and other symbiotic trees in Eastern North America. It can be found in the summer and fall growing singularly or (rarely) in small groups.

The cap shape is cushion-shaped to evenly rounded. The cap color is different hues of brown or maroon. The cap texture is finely powdery when young, turning smooth with age. When wet, it can be slightly tacky, with leaves or other debris commonly adhering to the surface as it dries. It bruises blue quickly and readily when handled.

The fertile surface under the cap is composed of yellow, circular to angular pores that also bruise blue where handled.

The stem is yellow commonly transitioning to a reddish color towards the base.

The inner flesh (context) of the mushroom is generally a similar color to the stem, which readily bruise blue when cut.

Though considered to be edible in the past, it has been determined to be a bio-accumultor of arsenic from the soil (Pavelle, 2015), which makes its edibility iffy.

July 26th, 2023 Field Notes - Indian Cave State Park:

Growing scattered in low East-facing mixed oak/hickory woodland.

• Cap brownish-tan with some maroon hues and velvety, bruising darker.
• Pore surface dingy yellow with irregular shaped pores that quickly turn dark blue when bruised.
• Stipe yellow at apex, quickly turning reddish brown clear to the base, also bruising dark blue.
• Basal mycelium white.
• Interior flesh yellowish, quickly turning dark blue where cut.

Additional Info

• Taste: acidic to mild
• Smell: not distinctive to reminiscent of Portabellas.
• KOH: orangish on pileipellis, dark buff-orange on pore surface.
• Ammonia darkening on pileipellis, pore surface, and stipe.

DNA ITS Barcode: GAACGCACCTTGCGCTCCTCGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATCGAATTCTCAACCATGCCCCTTTGTCAAAAGGACATGGCTTGGACTTTGGGAGCCTTGCTGGCCTTTTTGGTCAGCTCTCCTGAAATGCATTAGCGATGGGTGGGCAAGTCTTCATTAGAGACGTGCACGGCCTTCGACGTGATAATGATCGTCGTGGCTGGAGCGTCTTTATTCTTGCGATCCGTCCTCGCTCACAATCTCTGCTAGCCTTGGGTTAGCTTTTGGCTATTAGTTCGGTCACGAGACCTGACGAACGTCAGAGGTGCACCCCCAAGGACTGGTCGATTTCGAAACTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAA

The American Amber Jelly Fungus (Exidia crenata) is a decomposer of dead wood and can be found in the spring and fall. It is widespread east of the Rocky Mountains in North America.

The color is dark maroon to black. The consistency is elastic and jelly-like. It has a habit of growing in clusters. The spore print is white.

October 26th, 2023 Field Notes - Indian Cave State Parks

Spore Print: white

Field Characteristics:

39

Growing on fallen barkless hardwood log in moist oak/hickory woodland.

Field Characteristics:

491

Nickname: Flammulina nigrapes
Sequence Number: #0491
Observed At: Thursday, October 26, 2023 2:34 PM
Location: 40.245976872668614, -95.53594591526966

Form Group: Agaric

Habitat:

• Growth Habit: Connate to Single to Gregarious
• Substrate: Lignicolous
• Tree: Desciduous

Spores:

• Print color: white

The Mustard Yellow Polypore (Fuscoporia gilva) is a common decomposer of broadleaf wood that can be found year-round, but shows its most vivid colors during wet periods in the summer when it is actively growing. It is widely distributed in North America.

The cap surface color is reddish to yellow-mustard when young, becoming darker, then black with age. The fertile structure (hymenopore) color is similar or darker. The hymenopore consists of tiny pores.

This mushroom is easy to distinguish using drops KOH (black) and ammonia (darkening).

The inner flesh (context) is a yellow-mustard color and can be sometimes observed even when the mushroom is old and has turned black with age.

September 7th, 2023 Field Notes - Indian Cave State Park

Shelving gregariously on fallen Ash tree in open interface between riparian and mixed oak/hickory woodland areas.

• Caps thin with concentric zonation, brown with an orange-brown margin.
• Hymenophore finely poroid, primarily brown and orange-brown near margin.

Additional Info

• KOH blackish on all surfaces.
• Ammonia dark on all surfaces.

June 19th, 2024 Field Notes - NVR:

24-1458

Peduncle present

The Collared Earthstar (Geastrum triplex) is a decomposer that can be found growing alone or in groups under broadleaf trees in the summer and fall. It is widely distributed in North America and can be found in forest, urban, or suburban settings.

This mushroom produces spores enclosed within an egg-shaped case (sequestrate) fruiting body. It creates a star shape from an outer casing that splits radially and curls backwards to elevate the inner "egg" off the ground. This species creates a distinct "beak" at the top (apex) made of tiny threads that create a one-way passage for spore dispersal. The spores are brownish.

This mushroom utilizes disturbances in nature like rain drops as force to eject spores into wind currents to inoculate other areas. It is a fascinating example of nature using passive systems as a part of its lifecycle and function in the ecosystem.

September 1st, 2023 Field Notes - Indian Cave State Park

Growing gregariously from soil next to hardwood pile in low riparian woodland area.

• Smell: faint to not distinct.
• Taste: bitter
• Brown spores

Field Characteristics:

#462

-Growing in overlapping shelves on the trunk of dead American Sycamore tree in open horse pasture.

• Caps red, semicircular, lacquered, wrinkled with radial zonation.
• Hymenium brownish with tiny circular/round pores.
• Stipe absent.

Additional Details

• KOH black on non lacquered areas.
• Spore deposits on cap brown.

Field Characteristics:

#459

-Growing in shelves and resupinately on hardwood branch in mixed oak/hickory woodland.

• Caps round, flat and white.
• Hymenium whitish sterile surfaces and with brown round pores.
• Stipe absent

Additional Details

• Spore Print: white

Field Characteristics:

#413

-Growing at the base of large Northern Red Oak tree in mixed oak/hickory woodland just above creek.

• Cap consisting of an irregular rosette pattern of overlapping brownish-gray fronds, all fused at base. The colors are more pronounced on along the margins of each frond.
• Hymenium white consisting of a network of small irregular shaped pores.
• Stipe absent

Additional Details -Spore Print: white

The Oak-Loving Gymnopus can be found fruiting on sticks, twigs, and woodland duff and has a worldwide range. It can be found in spring, summer, and fall and is extremely common in wooded habitats.

Gymnopus dryophilus has a chestnut colored cap that is evenly rounded to flat. The gills are white, shallow, crowded, and are attached to the stem. It has a white spore print. The stem base is generally wider than the apex.

June 29th, 2023 Field Notes - Indian Cave State Park

• Growing scattered on oak woodland duff in small mixed oak/hickory woodland draw.
• Gills very shallow. Stipe somewhat elastic.
• KOH: slightly darkening pileipellis
• Taste: not distinctive.