Violet-Toothed Polypore (Trichaptum biforme)
Violet-Toothed Polypore (Trichaptum biforme)
Violet-Toothed Polypore (Trichaptum biforme)
Violet-Toothed Polypore (Trichaptum biforme)
Violet-Toothed Polypore (Trichaptum biforme)
Violet-Toothed Polypore (Trichaptum biforme)
Violet-Toothed Polypore (Trichaptum biforme)
Violet-Toothed Polypore (Trichaptum biforme)
Violet-Toothed Polypore (Trichaptum biforme)
Violet-Toothed Polypore (Trichaptum biforme)
Violet-Toothed Polypore (Trichaptum biforme)
Violet-Toothed Polypore (Trichaptum biforme)
Violet-Toothed Polypore (Trichaptum biforme)
Violet-Toothed Polypore (Trichaptum biforme)
Violet-Toothed Polypore (Trichaptum biforme)
Violet-Toothed Polypore (Trichaptum biforme)
< Back to Home

Violet-Toothed Polypore

Trichaptum biforme

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Hymenochaetales > Trichaptaceae > Trichaptum


Observations

May 15th, 2023 Indian Cave State Park
Violet-toothed Polypore (Trichaptum biforme)

15

Growing on the lower trunk of Northern Red Oak near mixed oak/hickory woodland edge.


Observation by thefungiproject
June 30th, 2024 Schramm Park
Violet-toothed Polypore (Trichaptum biforme)

Not Collected. Growing on dead Bitternut Hickory.


Observation by thefungiproject
July 11th, 2023 Indian Cave State Park
Violet-toothed Polypore (Trichaptum biforme)

#180

  • Growing abundantly on large downed Northern Red Oak in low, moist oak/hickory woodland draw.
  • Cap with concentric pale purple bands.
  • Hymenium toothed, with lilac sterile margin. Older specimens with a green algal component near the base spread out towards margin.
  • Smell: reminiscent of a household cleaner.
  • Taste: earthy (similar to Trametes versicolor).
  • KOH: darkens surfaces on cap and olive-brown on hymenium.
DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAGTTTTGAAGTGGGCTTGATGCTGGCTTGTAACAGAGCACTGTGCTCAGCCCCGCTCCAATCCATTCAACCCCTGTGCACTATTCGGAGTGTTGCAAGCTGAGACAATGTGGGGAGTGGTCCCGGTTGTATTTCTAATGCGACTTGGGCTTACTTTCAAACGGTCAAGGCTTGTCCTCCGGTTTATATTACAAACACTTTTATTGTCTTGTCGAATGTATTAGCCTCTCGTTAGGCGAAACTTAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGTTAATATCAACTCTGATGGTTTTTGTTAACCATTGGATGTTGGACTTGGAGGTTCGTGCTGGCTGCAAAGTCGGCTCCTCTTGAATGCATTAGCTTGGACCTGTGCGCGTTTGCTAGCGGTGTAATACATTTTATTCACCACGGGCCGTGTCACTATTAGGGTCTGCTTCTAATCGTCCTTACCGGACAATAATAAACTTTATGACTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject

Created February 26, 2026 at 8:43 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.