Snow Fungus (Tremella fuciformis)
Snow Fungus (Tremella fuciformis)
Snow Fungus (Tremella fuciformis)
Snow Fungus (Tremella fuciformis)
Snow Fungus (Tremella fuciformis)
Snow Fungus (Tremella fuciformis)
Snow Fungus (Tremella fuciformis)
Snow Fungus (Tremella fuciformis)
Snow Fungus (Tremella fuciformis)
Snow Fungus (Tremella fuciformis)
Snow Fungus (Tremella fuciformis)
Snow Fungus (Tremella fuciformis)
Snow Fungus (Tremella fuciformis)
Snow Fungus (Tremella fuciformis)
< Back to Home

Snow Fungus

Tremella fuciformis

Life > Fungi > Basidiomycota > Agaricomycotina > Tremellomycetes > Tremellomycetidae > Tremellales > Tremellaceae > Tremella


Description

The Snow Fungus (Tremella fuciformis) is a jelly fungus that grows on hardwood logs after heavy rains. It fruits from the summer through fall. It can sometimes become parasitized by Sporothrix epigloea.


Observations

July 25th, 2023 Indian Cave State Park
Snow Fungus (Tremella fuciformis)

#238

  • Growing scattered on fallen Northern Red Oak limb in mixed oak/hickory woodland near edge.
  • Fruiting bodies appear to have one focal attachment point to substrate.
  • Flesh semitranslucent, thin and loby.
  • Smell: not distinctive.
  • Taste: mildly acidic.

Spore Print: white.

DNA Barcode ITS:
GAACGCACCTTGCGCCTTTTGGTATTCCGAGAGGCATGCCTGTTTGAGTGTCATGTAGACTCAACCCCCCGGGTTTCCGACCCGGCGGAGTTGGATTTGGGCCCTGCCTTTCCCGGCTGGCCTTAAATGCGTTAGTGGTTTCACGCAGGACGTCGTAAGTTACGCGTCGACTGTGGGCCGCTCACAACCCCCCCTTTTGCACTCTGGCCTCAGATAGGTAGGGCTACCCGCTGAACTTAA

Observation by thefungiproject
June 30th, 2024 Schramm Park
Snow Fungus (Tremella fuciformis)

Not Collected.


Observation by thefungiproject
September 24th, 2024 Indian Cave State Park
Snow Fungus (Tremella fuciformis)

Not Collected. Growing on fallen Chinkapin Oak limb.


Observation by thefungiproject

References

Kuo, M. (2008, November). Tremella fuciformis. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/tremella_fuciformis.html


Created December 15, 2025 at 10:41 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.