Deer-Colored Trametes
Trametopsis cervina
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Polyporales > Irpicaceae > Trametopsis
Description
The Deer-colored Trametes (Trametopsis cervina) is a decomposer of wood and can be found from spring through fall. It grows somewhat lumpy and crust-like until it develops cap shapes. The caps are irregular in outline (not smooth toward the cap margin) and does not have a stem (sessile). The cap is orangish, brownish, or "deer-colored" and features zones of slightly different color and texture. The pore surface is whitish and turns brown with age. The pores begin slot-like, becoming toothed with age.
Observations
June 28th, 2023 Indian Cave State Park

#144
Growing on large rotting hardwood log in the bottom of large, moist woodland draw.
Flesh tough and spongy, saturated with water hirsute (hairy). Concentric zoning and outer margin lighter color. Cap yellow-orange on top and white to orange on hymenium. Pores irregular and almost maze-like.
KOH: Instantly brown on cap and hymenium. Ammonia: Quickly darkening surfaces then returning to normal color. Taste: Faintly bitter. Smell: Strong, reminiscent of Ganoderma applanatum. Sporeprint: White
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAGTTTATTGGACGGGTTGTCGCTGGCCTTTACCGGCAATGTGCACGCCTGGCTCAATTTTCCACTCTTTAACCACTGTGCACTTTTTGTAAGATTGTCTGTAAGGGAATTATATTTTTACTCTCTTGGTAACACATGAGACGAAAGTATATATTGCCTGAAGGCCTCTCTTATGTTTACTACAAACGCTTCAGTTATTAGAATGTCATACTTGTGTTATAACACATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCATTAGATTTTTTTTTCTAATGCAGCTTGGACTTGGAGGTTGTGTCGGTTTTTAATAATCGACTCCTCTTAAATGCATTAGCGTGAATTCTTACGGATCGCCTTCAGTGTGATAATTATCTACGCTGTGGTGTGAAGTATCATTATGTTCATGCTTATAATCGTCTGTTCATCAGACAATTTATTATGACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGView MycoMap DNA Results
References
Kuo, M. (2025, February). Trametopsis cervina. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/trametopsis_cervina.html
Created October 14, 2025 at 3:03 PM