Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
Lumpy Bracket (Trametes gibbosa)
< Back to Home

Lumpy Bracket

Trametes gibbosa

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Polyporales > Polyporaceae > Trametes


Description

The Lumpy Bracket (Trametes gibbosa) is a decomposer of wood that can be found year-round. Common in woodlands, it features a mostly white or cream-colored lumpy cap that sometimes cultures algae appearing vivid green.

The cap is shaped like a half-circle or kidney-shaped when viewed from the top (in outline), and is generally quite flat (other than the "lumpiness"). It is a tough perennial polypore (aka gargoyle) and can be found growing alone or in small to large groups. Some caps can grow up to a foot in diameter or larger. The caps are tough and leathery.

The hymenophore consists of elongated, sausage-shaped, or maze-like pores. It has a white spore print.


Observations

May 16th, 2023 Indian Cave State Park
Lumpy Bracket (Trametes gibbosa)

35

Growing from fallen elm logs in low mixed oak/hickory woodland area.


Observation by thefungiproject
July 26th, 2023 Indian Cave State Park
Lumpy Bracket (Trametes gibbosa)

#246

  • Growing down the trunk of American Hophornbeam tree on west-facing mixed oak/hickory woodland slope, above creek.
  • Flesh tough, leathery and lumpy.
  • Some specimens encapsulating old fruiting bodies, sometimes just the hymenium.
  • Hymenium elongated pores on areas of fresh growth while maze-like when mature, slightly bruising brown.
  • Smell: faintly sweet.
  • Taste: slightly bitter.
  • KOH: yellow on new growth.
  • Ammonia darkening, to not distinctive.
  • UV: bright pink on hymenium.
  • Spore Print: white.
DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAGTTTTGAAATGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTAGGTCTGCGTGGGTTTCTAGCCTCCGGGTTGGGAGCATTCTGCAGGCTTATGTATACTATAAACACTTTAAAGTAACAGAATGTAAACGCGTCTAACGCATTTTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTTCAACCCATAAATCCTTGTGGAAGTATGGGCTTGGATTTGGAGGTTTGCTGGGTCCCCTGGGGTCCGGCTCCTCTCGAACGCATTAGCTTGATTCCGTGCGGATCGGCTCTCAGTGTGATAATTATCTACGCTGTGACCGTGAAGCGTTTGGCGAGCTTCCAACCGTCTTTTTTGGACAACCTTATGACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject
August 17th, 2023 Indian Cave State Park
Lumpy Bracket (Trametes gibbosa)

#327

  • Growing gregariously on fallen American Sycamore in low, open riparian woodland area.
  • Cap lumpy, concentrically zoned, alternating between white, cream, and gray violet. Some specimens with green algal component.
  • Hymenium poroid, elongated, irregular and mazelike.

Additional Info

  • White spore deposit on log.
  • KOH darkening pileipellis and hymenium.
  • Ammonia darkening pileipellis and hymenium.

Observation by thefungiproject
September 12th, 2024 Neale Woods
Lumpy Bracket (Trametes gibbosa)

Not Collected.

Growing on fallen Basswood in upland oak woodland slope.


Observation by thefungiproject
September 12th, 2024 Neale Woods
Lumpy Bracket (Trametes gibbosa)

Not Collected.


Observation by thefungiproject
September 12th, 2024 Neale Woods
Lumpy Bracket (Trametes gibbosa)

Not Collected.


Observation by thefungiproject

References

Kuo, M. (2023, March). Trametes gibbosa. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/trametes_ gibbosa.html


Created February 21, 2026 at 10:41 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.