Lumpy Bracket
Trametes gibbosa
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Polyporales > Polyporaceae > Trametes
Description
The Lumpy Bracket (Trametes gibbosa) is a decomposer of wood that can be found year-round. Common in woodlands, it features a mostly white or cream-colored lumpy cap that sometimes cultures algae appearing vivid green.
The cap is shaped like a half-circle or kidney-shaped when viewed from the top (in outline), and is generally quite flat (other than the "lumpiness"). It is a tough perennial polypore (aka gargoyle) and can be found growing alone or in small to large groups. Some caps can grow up to a foot in diameter or larger. The caps are tough and leathery.
The hymenophore consists of elongated, sausage-shaped, or maze-like pores. It has a white spore print.
Observations
May 16th, 2023 Indian Cave State Park

35
Growing from fallen elm logs in low mixed oak/hickory woodland area.
July 26th, 2023 Indian Cave State Park

#246
- Growing down the trunk of American Hophornbeam tree on west-facing mixed oak/hickory woodland slope, above creek.
- Flesh tough, leathery and lumpy.
- Some specimens encapsulating old fruiting bodies, sometimes just the hymenium.
- Hymenium elongated pores on areas of fresh growth while maze-like when mature, slightly bruising brown.
- Smell: faintly sweet.
- Taste: slightly bitter.
- KOH: yellow on new growth.
- Ammonia darkening, to not distinctive.
- UV: bright pink on hymenium.
- Spore Print: white.
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAGTTTTGAAATGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTAGGTCTGCGTGGGTTTCTAGCCTCCGGGTTGGGAGCATTCTGCAGGCTTATGTATACTATAAACACTTTAAAGTAACAGAATGTAAACGCGTCTAACGCATTTTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTTCAACCCATAAATCCTTGTGGAAGTATGGGCTTGGATTTGGAGGTTTGCTGGGTCCCCTGGGGTCCGGCTCCTCTCGAACGCATTAGCTTGATTCCGTGCGGATCGGCTCTCAGTGTGATAATTATCTACGCTGTGACCGTGAAGCGTTTGGCGAGCTTCCAACCGTCTTTTTTGGACAACCTTATGACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTView MycoMap DNA Results
August 17th, 2023 Indian Cave State Park

#327
- Growing gregariously on fallen American Sycamore in low, open riparian woodland area.
- Cap lumpy, concentrically zoned, alternating between white, cream, and gray violet. Some specimens with green algal component.
- Hymenium poroid, elongated, irregular and mazelike.
Additional Info
- White spore deposit on log.
- KOH darkening pileipellis and hymenium.
- Ammonia darkening pileipellis and hymenium.
September 12th, 2024 Neale Woods

Not Collected.
Growing on fallen Basswood in upland oak woodland slope.
References
Kuo, M. (2023, March). Trametes gibbosa. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/trametes_ gibbosa.html
Created March 17, 2026 at 9:26 PM

































