Lumpy Bracket
Trametes gibbosa
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Polyporales > Polyporaceae > Trametes
Description
The Lumpy Bracket (Trametes gibbosa) is a decomposer of wood that can be found year-round. Common in woodlands, it features a mostly white or cream-colored lumpy cap that sometimes cultures algae appearing vivid green.
The cap is shaped like a half-circle or kidney-shaped when viewed from the top (in outline), and is generally quite flat (other than the "lumpiness"). It is a tough perennial polypore (aka gargoyle) and can be found growing alone or in small to large groups. Some caps can grow up to a foot in diameter or larger. The caps are tough and leathery.
The hymenophore consists of elongated, sausage-shaped, or maze-like pores. It has a white spore print.
Observations
May 16th, 2023 Indian Cave State Park
35
Growing from fallen elm logs in low mixed oak/hickory woodland area.
July 26th, 2023 Indian Cave State Park
#246
- Growing down the trunk of American Hophornbeam tree on west-facing mixed oak/hickory woodland slope, above creek.
- Flesh tough, leathery and lumpy.
- Some specimens encapsulating old fruiting bodies, sometimes just the hymenium.
- Hymenium elongated pores on areas of fresh growth while maze-like when mature, slightly bruising brown.
- Smell: faintly sweet.
- Taste: slightly bitter.
- KOH: yellow on new growth.
- Ammonia darkening, to not distinctive.
- UV: bright pink on hymenium.
- Spore Print: white.
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAGTTTTGAAATGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTAGGTCTGCGTGGGTTTCTAGCCTCCGGGTTGGGAGCATTCTGCAGGCTTATGTATACTATAAACACTTTAAAGTAACAGAATGTAAACGCGTCTAACGCATTTTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTTCAACCCATAAATCCTTGTGGAAGTATGGGCTTGGATTTGGAGGTTTGCTGGGTCCCCTGGGGTCCGGCTCCTCTCGAACGCATTAGCTTGATTCCGTGCGGATCGGCTCTCAGTGTGATAATTATCTACGCTGTGACCGTGAAGCGTTTGGCGAGCTTCCAACCGTCTTTTTTGGACAACCTTATGACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTView MycoMap DNA Results
September 12th, 2024 Neale Woods
Not Collected.
Growing on fallen Basswood in upland oak woodland slope.
August 17th, 2023 Indian Cave State Park
#327
- Growing gregariously on fallen American Sycamore in low, open riparian woodland area.
- Cap lumpy, concentrically zoned, alternating between white, cream, and gray violet. Some specimens with green algal component.
- Hymenium poroid, elongated, irregular and mazelike.
Additional Info
- White spore deposit on log.
- KOH darkening pileipellis and hymenium.
- Ammonia darkening pileipellis and hymenium.
References
Kuo, M. (2023, March). Trametes gibbosa. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/trametes_ gibbosa.html
Created August 25, 2025 at 9:43 AM and last updated August 25, 2025 at 9:43 AM