American Lurid Bolete (Suillellus ameriluridus)
American Lurid Bolete (Suillellus ameriluridus)
American Lurid Bolete (Suillellus ameriluridus)
American Lurid Bolete (Suillellus ameriluridus)
American Lurid Bolete (Suillellus ameriluridus)
American Lurid Bolete (Suillellus ameriluridus)
American Lurid Bolete (Suillellus ameriluridus)
American Lurid Bolete (Suillellus ameriluridus)
American Lurid Bolete (Suillellus ameriluridus)
American Lurid Bolete (Suillellus ameriluridus)
American Lurid Bolete (Suillellus ameriluridus)
American Lurid Bolete (Suillellus ameriluridus)
American Lurid Bolete (Suillellus ameriluridus)
< Back to Home

American Lurid Bolete

Suillellus ameriluridus

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Boletales > Boletaceae > Suillellus


Description

The American Lurid Bolete (Suillellus ameriluridus) is a mycorrhizal mushroom that is distributed east of the Rocky Mountains and associated with Oak trees. It can be found in the summer and fall. This mushroom is vividly colored and bruises blue where handled. Suillellus ameriluridus is a provisional name. It is awaiting final publication distinguishing the European Suillellus luridus from this species. More bolete news to come!

The word lurid gives credence to its absurd coloration.

Lurid (adjective): Vivid in a way that is intended to shock or be sensational, often by emphasizing details that are shocking, gruesome, or exaggerated (Merriam-Webster, 2025).

Blue

The stem is yellow/red and has a reddish fish net-like pattern (reticulation) easily bruising blue to the touch. It is generally more red towards the base of the tapering stem.

Stem Color:

Deep Reddish Orange
#AA381E
Strong Orange Yellow
#EAA221
Bruising
Deep Blue
#00416A
Blackish Blue
#202830

Stem

Its pore color starts a dark red or orangish when young, transitioning into an orange to yellow color when mature. Quickly staining blue when cut.

Pore color:

Dark Red
#722F37
Deep Reddish Orange
#AA381E
Aging to
Strong Reddish Orange
#D9603B
Strong Orange Yellow
#EAA221
Deep Orange Yellow
#C98500
Bruising
Brilliant Blue
#4997D0
Strong Blue
#0067A5
Deep Blue
#00416A
Blackish Blue
#202830

Pores

S. ameriluridus promptly turns blue where cut, later transitioning to blackish.

Bruising
Brilliant Blue
#4997D0
Strong Blue
#0067A5
Deep Blue
#00416A
Blackish Blue
#202830

Cut Blue

Edibility for this species is currently considered iffy (Pavelle, 2015) and not advised by the authors of this webpage.

August 1st, 2023 Field Notes - Indian Cave State Park:

  • Growing gregariously in open mixed oak woodland edge.
  • Nearby Trees: Black Walnut, American Linden, Bur Oak, Northern Red Oak, Elm, Ash and Black Oak.
  • Cap light orange, bald, slowly bruising dark blue where handled/damaged. Pileipellis color rubbing off on fingers and collection bag.
  • Hymenium dingy orange, with large circular pores that quickly bruise dark blue where handled/damaged, sunken at stipe apex.
  • Stipe light yellow at apex with numerous small reddish-brown scabers, turning wine red and subtomentose at base.
  • Basal mycelium pale yellowish.
  • Tube layer easily separable from orange trama.
  • Outer flesh staining wax bags yellow.
  • Smell: not distinctive
  • Taste: not distinctive
  • KOH: Dark orange on pileipellis, stipe flesh and tube layer, and pale orange on trama.
  • Ammonia yellowish-green on pileipellis, pale orange on trama, yellowish on tube layer and stipe flesh.
  • FeSO4 dark gray on pileipellis.
  • Spore Print: light olive brown.

DNA Barcode ITS: GAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATCGAATTCTCAACCATGTCTTGATCGATTTCGAGGCCATGGCTTGGAGTTGGGGGTTGCTGGCGGCGACGAGCCGTCGGCTCCCCTGAAATGCATTAGCGAAGGGCAGCAAGTCTCTCGACGTGCACGGCCTTCGACGTGATAATGATCGTCGTGGCTGGAGCGTTCGGACTGCATGAATGGTCCTGTGCTTCTAATGTCCCCCATCGCCTTATGGCGTGTGTTTCGAAACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA

Observation


References

Kuo, M. (2015, January). Boletus luridus. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/boletus_luridus.html

Merriam-Webster. (2025). Definition of Lurid. Merriam-Webster Dictionary; Merriam-Webster. https://www.merriam-webster.com/dictionary/lurid

Pavelle, S. (2015, July 24). Suillellus luridus. The Bolete Filter. https://boletes.wpamushroomclub.org/product/boletus-luridus/

Zeller, D. (2025, January). Nature Colors. Retrieved from beta site: https://naturecolors.netlify.app/


Created August 25, 2025 at 9:43 AM and last updated August 25, 2025 at 9:43 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025