undefined (Sporothrix epigloea)
undefined (Sporothrix epigloea)
undefined (Sporothrix epigloea)
undefined (Sporothrix epigloea)
undefined (Sporothrix epigloea)
undefined (Sporothrix epigloea)
undefined (Sporothrix epigloea)
undefined (Sporothrix epigloea)
undefined (Sporothrix epigloea)
undefined (Sporothrix epigloea)
undefined (Sporothrix epigloea)
undefined (Sporothrix epigloea)
undefined (Sporothrix epigloea)
undefined (Sporothrix epigloea)
undefined (Sporothrix epigloea)
< Back to Home

Sporothrix epigloea

Life > Fungi > Ascomycota > Pezizomycotina > Sordariomycetes > Sordariomycetidae > Ophiostomatales > Ophiostomataceae > Sporothrix


Description

Sporothrix epigloea is a tiny parasite that grows on Snow Fungus (Tremella fuciformis) and can be found in the fall. It features tiny pointed clubs that can be difficult to see to the naked eye.


Observations

August 1st, 2023
 (Sporothrix epigloea)

#272

  • Growing on Tremella fuciformis fruiting bodies, that are fruiting from fallen Northern Red Oak limb in open mixed oak/hickory woodland.
  • Fruiting bodies black and spine-like, some with fine droplet at the tip.
  • Some nearby Tremella specimens starting to dissolve.
DNA Barcode ITS:
GTCATAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGAGTGCCGATGAAAGGCTATCCAAACACCTGTGCACATCGGACCGTGCCCCCTGCCCGGGGGCTCGGCCGCCTTCACACAAACGCGTGTCACGAACGTAATGCATCATAACATGAAACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAACGCGATATGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAGAGGCATGCCTGTTTGAGTGTCATGTAGACTCAACCCCCCGGGTTTCCGACCCGGCGGAGTTGGATTTGGGCCCTGCCTTTCCCGGCTGGCCTTAAATGCGTTAGTGGTTTCACGCAGGACGTCGTAAGTTACGCGTCGACTGTGGGCCGCTCACAACCCCCCCCTTTTGCACTCTGGCCTCAGATAGGTAGGGCTACCCGCTGAACTT

Observation by thefungiproject
June 30th, 2024 Schramm Park
 (Sporothrix epigloea)

AB02


Observation by thefungiproject

Created May 19, 2025 at 9:31 PM and last updated May 19, 2025 at 9:31 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025