Leopard Earthball
Scleroderma areolatum
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Boletales > Sclerodermataceae > Scleroderma
Description
The Leopard Earthball (Scleroderma areolatum) is a mycorrhizal sequestrate fungi that can be found in the summer and fall. It features a brown mud-cracked pattern of scales that can be brushed off (areolate) across a yellowish ball shape. The contents are white when young, later turning purplish and blackish, and responding with an orange color when KOH is applied. The smell is sweet or similar to a #2 pencil eraser. The spores are spiked.
This genus is known to be poisonous.
Observations
June 27th, 2023 Indian Cave State Park

125
Growth pattern and habitat: Growing gregariously on well-decayed (white rot) hardwood stump in large woodland draw bottom dominated by paw paw trees.
Smell: Strong and chemically.
KOH: Orangish-red on exterior surface.
Additional Details: Rhizomorphs abundant, clinging onto substrate debris. Surface covered with small removable scales.
Microscopy: mounted in Melzer's Reagent.
GAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATCGAAACCTCAGACCGACCCTTCGACCCCGTCGGAGCTCGGTCTGGACTTGTGGGAGTCTGCGGGCGAAGCGTGACTTCGTCGGCTCTCCTCAAAAGCATTAGCCGTGGGTGGCGAGCCTGGCATGGCACGGCCTCCTCGACGTCGTAATGATCGTCGTGGGCTGGAAGTGTACGGCTCGACGGACCCATGCTTCGCAAGTCTTGCGAGCCCGTCCCTCGCGGACGGCCGCGCCCCATCGAAGCTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAView MycoMap DNA Results
References
Kuo, M. (2004, December). Scleroderma areolatum. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/scleroderma_areolatum.html
Created August 10, 2026 at 10:51 AM





