Leopard Earthball (Scleroderma areolatum)
Leopard Earthball (Scleroderma areolatum)
Leopard Earthball (Scleroderma areolatum)
Leopard Earthball (Scleroderma areolatum)
Leopard Earthball (Scleroderma areolatum)
Leopard Earthball (Scleroderma areolatum)
Leopard Earthball (Scleroderma areolatum)
< Back to Home

Leopard Earthball

Scleroderma areolatum

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Boletales > Sclerodermataceae > Scleroderma


Description

The Leopard Earthball (Scleroderma areolatum) is a mycorrhizal sequestrate fungi that can be found in the summer and fall. It features a brown mud-cracked pattern of scales that can be brushed off (areolate) across a yellowish ball shape. The contents are white when young, later turning purplish and blackish, and responding with an orange color when KOH is applied. The smell is sweet or similar to a #2 pencil eraser. The spores are spiked.

This genus is known to be poisonous.


Observations

June 27th, 2023 Indian Cave State Park
Leopard Earthball (Scleroderma areolatum)

125

Growth pattern and habitat: Growing gregariously on well-decayed (white rot) hardwood stump in large woodland draw bottom dominated by paw paw trees.

Smell: Strong and chemically.

KOH: Orangish-red on exterior surface.

Additional Details: Rhizomorphs abundant, clinging onto substrate debris. Surface covered with small removable scales.

Microscopy: mounted in Melzer's Reagent.

DNA Barcode ITS:
GAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATCGAAACCTCAGACCGACCCTTCGACCCCGTCGGAGCTCGGTCTGGACTTGTGGGAGTCTGCGGGCGAAGCGTGACTTCGTCGGCTCTCCTCAAAAGCATTAGCCGTGGGTGGCGAGCCTGGCATGGCACGGCCTCCTCGACGTCGTAATGATCGTCGTGGGCTGGAAGTGTACGGCTCGACGGACCCATGCTTCGCAAGTCTTGCGAGCCCGTCCCTCGCGGACGGCCGCGCCCCATCGAAGCTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA
View MycoMap DNA Results
Observation by thefungiproject

References

Kuo, M. (2004, December). Scleroderma areolatum. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/scleroderma_areolatum.html


Created October 14, 2025 at 3:03 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.