Stalked Scarlet Cup (Sarcoscypha occidentalis)
Stalked Scarlet Cup (Sarcoscypha occidentalis)
Stalked Scarlet Cup (Sarcoscypha occidentalis)
Stalked Scarlet Cup (Sarcoscypha occidentalis)
Stalked Scarlet Cup (Sarcoscypha occidentalis)
Stalked Scarlet Cup (Sarcoscypha occidentalis)
Stalked Scarlet Cup (Sarcoscypha occidentalis)
Stalked Scarlet Cup (Sarcoscypha occidentalis)
Stalked Scarlet Cup (Sarcoscypha occidentalis)
< Back to Home

Stalked Scarlet Cup

Sarcoscypha occidentalis

Life > Fungi > Ascomycota > Pezizomycotina > Pezizomycetes > Pezizomycetidae > Pezizales > Sarcoscyphaceae > Sarcoscypha


Description

The Stalked Elf Cup (Sarcoscypha occidentalis) is a decomposer of deciduous twigs and duff (sometimes submerged in soil) and can be found in the spring through summer. It can be found east of the Rocky Mountains in North America through Mexico.

The Sarcoscypha occidentalis group can be distinguished from other Sarcoscypha by the presence of a stem. North America may see the group split into several distinct species in the coming decades, as DNA testing suggests that Sarcoscypha occidentalis-IN03 could be a different species than others in the group. The fruiting body is saucer-shaped, scarlet colored on top and whitish on the bottom (the scarlet color shows through creating a muted scarlet effect). The stem is white, with cottony basal mycelial threads commonly present.


Observations

May 15th, 2023 Indian Cave State Park
Stalked Scarlet Cup (Sarcoscypha occidentalis)

12

Growing deeply rooted (long stipe) among oak woodland duff in large draw in mixed oak/hickory woodland.


Observation by thefungiproject
July 8th, 2024
Stalked Scarlet Cup (Sarcoscypha occidentalis)

AB13


Observation by thefungiproject
June 14th, 2023 Indian Cave State Park
Stalked Scarlet Cup (Sarcoscypha occidentalis)

#108

Growing from submerged hardwood twig in low riparian woodland draw near creek.

Nearby trees: Elm, Black Walnut, and Honey Locust.

Long stipe

DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACCGAACCAGGCGCCCGGTTGGGACGTGTGCCACGTCCCGGCCCGGGGGCTAAGTTTTCCAAACCCTCTGTGTACCTTTACCTTTGTTGCTTCCCGCCGGGTTTGCGCCCGGCGGGGAGGTCTACCAAACTCATGTTTTTCCATGCAGTCAGTTAGTGCGGCTCGTCCGCGTATATCTAAAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCGTCAAACCCCCTCAAGCTCTTTTGCTTGGTCATGGCGGAAGATCCCCTCCCCCGGGAGGAGTTCCCCGTCCAAAGGAATCTGGCGGAGAGCCTGGTCCTCGGAGACGTAGTGAGCAATTCTATCGTCCGTTGAGCGATCAGTTATCCAGCCGACAACCCCAAACTTTTCTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

Observation by thefungiproject

Created June 26, 2025 at 10:30 AM and last updated June 26, 2025 at 10:30 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025