Stalked Scarlet Cup
Sarcoscypha occidentalis
Life > Fungi > Ascomycota > Pezizomycotina > Pezizomycetes > Pezizomycetidae > Pezizales > Sarcoscyphaceae > Sarcoscypha
Description
The Stalked Elf Cup (Sarcoscypha occidentalis) is a decomposer of deciduous twigs and duff (sometimes submerged in soil) and can be found in the spring through summer. It can be found east of the Rocky Mountains in North America through Mexico.
The Sarcoscypha occidentalis group can be distinguished from other Sarcoscypha by the presence of a stem. North America may see the group split into several distinct species in the coming decades, as DNA testing suggests that Sarcoscypha occidentalis-IN03 could be a different species than others in the group. The fruiting body is saucer-shaped, scarlet colored on top and whitish on the bottom (the scarlet color shows through creating a muted scarlet effect). The stem is white, with cottony basal mycelial threads commonly present.
Observations
May 15th, 2023 Indian Cave State Park

12
Growing deeply rooted (long stipe) among oak woodland duff in large draw in mixed oak/hickory woodland.
June 14th, 2023 Indian Cave State Park

#108
Growing from submerged hardwood twig in low riparian woodland draw near creek.
Nearby trees: Elm, Black Walnut, and Honey Locust.
Long stipe
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACCGAACCAGGCGCCCGGTTGGGACGTGTGCCACGTCCCGGCCCGGGGGCTAAGTTTTCCAAACCCTCTGTGTACCTTTACCTTTGTTGCTTCCCGCCGGGTTTGCGCCCGGCGGGGAGGTCTACCAAACTCATGTTTTTCCATGCAGTCAGTTAGTGCGGCTCGTCCGCGTATATCTAAAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCGTCAAACCCCCTCAAGCTCTTTTGCTTGGTCATGGCGGAAGATCCCCTCCCCCGGGAGGAGTTCCCCGTCCAAAGGAATCTGGCGGAGAGCCTGGTCCTCGGAGACGTAGTGAGCAATTCTATCGTCCGTTGAGCGATCAGTTATCCAGCCGACAACCCCAAACTTTTCTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG
Created June 26, 2025 at 10:30 AM and last updated June 26, 2025 at 10:30 AM