Dudley's Elf Cup (Sarcoscypha dudleyi)
Dudley's Elf Cup (Sarcoscypha dudleyi)
Dudley's Elf Cup (Sarcoscypha dudleyi)
Dudley's Elf Cup (Sarcoscypha dudleyi)
Dudley's Elf Cup (Sarcoscypha dudleyi)
Dudley's Elf Cup (Sarcoscypha dudleyi)
Dudley's Elf Cup (Sarcoscypha dudleyi)
Dudley's Elf Cup (Sarcoscypha dudleyi)
Dudley's Elf Cup (Sarcoscypha dudleyi)
Dudley's Elf Cup (Sarcoscypha dudleyi)
< Back to Home

Dudley's Elf Cup

Sarcoscypha dudleyi

Life > Fungi > Ascomycota > Pezizomycotina > Pezizomycetes > Pezizomycetidae > Pezizales > Sarcoscyphaceae > Sarcoscypha


Description

Dudley's Elf Cup (Sarcoscypha dudleyi) is a decomposer that can be found in the spring and fall. It grows on twigs and branches submerged in soil and duff in wooded areas and is distributed east of the Rocky Mountains in North America.

Sarcoscypha dudleyi is scarlet colored (neon reddish-orange) on top and a lighter color on the bottom of its disc. It is uncommon in comparison to other Elf Cups and is most easily distinguished from the others by its "clam-shape" when young. It sometimes flattens with age.


Observations

November 21st, 2024 Indian Cave State Park
 (Sarcoscypha dudleyi)

Not collected

October 25th, 2023 Indian Cave State Park
 (Sarcoscypha dudleyi)

483

Nickname: Sarcoschypha dudleii
Sequence Number: #0483
Observed At: Thursday, October 26, 2023 10:31 AM
Location: 40.260398723055, -95.56707560316735

Form Group: Cup fungi

Habitat:
  • Growth Habit: Scattered to Single
  • Substrate: Lignicolous [1]
  • Tree: [2]

Attachment: Sessile

[1] Growing on submerged wood.

[2] Linden

DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCAAGGAAGCGCCCGGGGCCTCGGCCCGGGGCGCGGACTTACCAAACCCTCTGTGTACCTTTACCTTTGTTGCTTCCCGTCGGGTTTGCGCCCGGCGGGGGAGGTCCACCAAACTCATGTTTTTCCATGCAGTCAGTAGAGCGGCTCGTCCGCGAAAATTTAAAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGGCATGCCTGTCCGAGCGTCGTCAAACCCCCTCAAGCTCCTTTGCTTGGTCATGGTGGAAGATCCCCTCCCCGGAGGGGTTCCCCGCTTAAAGGAATCTGGCGGAGAGCCTGGTCCTCGGAGACGTAGTAAGCAATTCTATCGTCTCTCGAGCGATCATCTCCCAGCCGACAACCCCAAACTTTTCTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTT

References

Kuo, M. (2012, April). Sarcoscypha dudleyi. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/sarcoscypha_dudleyi.html

Kuo, M. (2012, April). The genus Sarcoscypha. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/sarcoscypha.html

Sarcoscypha dudleyi (Peck) Baral, Zeitschrift für Mykologie 50: 124 (1984) [MB#107274]

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Field Guide Download | About | Contact | © Fungi Project 2025