undefined (Russula sp-NE02)
undefined (Russula sp-NE02)
undefined (Russula sp-NE02)
undefined (Russula sp-NE02)
undefined (Russula sp-NE02)
undefined (Russula sp-NE02)
undefined (Russula sp-NE02)
undefined (Russula sp-NE02)
undefined (Russula sp-NE02)
< Back to Home

Russula sp-NE02

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Russulales > Russulaceae > Russula


Description

Russula sp-NE02 is a temporary name for a yet to be described Brittlegill species recorded from Indian Cave State Park in eastern Nebraska. This mushroom was observed growing from compacted soil covered in moss in an open mixed oak woodland.


Observations

June 14th, 2023 Indian Cave State Park
Brittlegills (Russula sp-NE02)

116

Growing from compacted soil covered in moss in open mixed oak woodland near Northern Red Oak, Eastern Red Cedar, Black Oak, Roughleaf Dogwood, and distant Chinkapin Oak trees. 3cm tall and 6cm wide.

  • Cap and hymenophore fairly flexible for a Russula species.
  • Gills appear almost waxy.
  • Trama gritty, cellular, apple-like.
  • Taste: Slowly acrid.
  • KOH slowly turning light orange on trama near the cap margin.
DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAATGGGGGTACCAAGGCTGTCGCTGACTTTTGTCGTGCACGCCCGAGTGCTCTCACATACAAAATATCCATCTCACCCCTTTGTGCATCACCGCGTGGGTCCCCCTTCCTCGGAGGGGGTGCTCACGTTTTTAACATTAAACACCCATTCGAACGTAGTGTAGAATGTTCTTTGTGCGATCACGCACGATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAACATCCTCAACCTGCTTGGTTTTATCAAACCAAAAGTAGGCTTGGAATTTGGAGGTTTTCTGCTGGCCTCCTCCGAAGCCAGCTCCTCTTAAATGTATCAGTGGGATCCGCTTTGCTAGATCCTCGACGTTGATAAGATGTTTCTACGTCTTGGGTTTCGCTCGGGAAGGAACCTGCTTCTAACCGTCCCATCAGGGACAATGTTCGAGCCGATCGCCCTTCACGGGGTGGGAAGCTTTCGACCCGTGAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject

Created August 25, 2025 at 9:43 AM and last updated August 25, 2025 at 9:43 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025