undefined (Russula sp-IN65)
undefined (Russula sp-IN65)
undefined (Russula sp-IN65)
undefined (Russula sp-IN65)
undefined (Russula sp-IN65)
undefined (Russula sp-IN65)
undefined (Russula sp-IN65)
undefined (Russula sp-IN65)
undefined (Russula sp-IN65)
undefined (Russula sp-IN65)
undefined (Russula sp-IN65)
< Back to Home

Russula sp-IN65

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Russulales > Russulaceae > Russula


Description

Russula sp-IN65 is a mycorrhizal mushroom that can be found in the summer in woodland settings. This one was found in an Oak/Hickory woodland growing from a moss patch near American Hophornbeam, Black Oak, Northern Red Oak, Chinkapin Oak and Black Cherry trees.


Observations

July 11th, 2023 Indian Cave State Park
Brittlegills (Russula sp-IN65)

#178

  • Growing solitarily in moss in open mixed oak woodland edge.
  • Nearby Trees: American Hophornbeam, Black Oak, Northern Red Oak, Chinkapin Oak and distant Black Cherry.
  • Cap overall gray with intermixed colors like pink, lilac, and brown especially towards the center.
  • Lammellae flexible (atypical of Russula), forking occasionally near the margin, with crossveins near the margin.
  • KOH: light orange on pileipellis, yellowish on stipe, and slightly darkening lamellae.
DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATAGTACAACGGAGGCACCTGGGCTGTCGCTGACCTTTGAAACGAAAAGGACGTGCACGCCCGGAGTGCTCTCTCACATCCATCTCACCCCTTTGTGCATCACCGCGTGGGGCCCTCTCTTTTGGCTTGTTCCGGGAGGGGGGTTCCATGTTTTTACATGAACAACCCATTAATGCATGTGTAGAATGTCTTACTTATTTTAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGTGCACCCGTTTGAGTGTCGTGAACACCCTCAACCTTCTTGGTTTATCGACCGGGAAGGCTTGGACTTTGGAGGTTTTTGTTGCTGGCCTCGTTTGAAGCCAGCTCCTCCTAAACGAATTAGTGAGGCCCGCCGTGCCGATCCTCGACGTGATAAGTACGCTTCTACGTCTTGGGGTTTCGCACCGTTCTCGCTTCCAACTTCGAGTCGTGACTCGACCTTATAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAAG
View MycoMap DNA Results
Observation by thefungiproject

Created March 17, 2026 at 9:26 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.