Purple-Bloom Russula (Russula sp-IN22)
Purple-Bloom Russula (Russula sp-IN22)
Purple-Bloom Russula (Russula sp-IN22)
Purple-Bloom Russula (Russula sp-IN22)
Purple-Bloom Russula (Russula sp-IN22)
Purple-Bloom Russula (Russula sp-IN22)
Purple-Bloom Russula (Russula sp-IN22)
< Back to Home

Purple-Bloom Russula

Russula sp-IN22

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Russulales > Russulaceae > Russula


Description

The Purple-Bloom Russula (Russula sp-IN22) is a colorful mycorrhizal mushroom that can be found in woodland settings in the summer. This one was found in an Oak/Hickory woodland at Indian Cave State Park in eastern Nebraska growing from soil near Chinkapin Oak, Shagbark Hickory, Northern Red Oak, Bur Oak, Black Oak, distant Elm and Black Walnut trees.

The smell and taste are pleasant, reminding the mycologist of floral notes. It's distinctly purple with reddish hints and the gills are yellow. The large cap creates a bowl in the center (narrowly depressed) with age. It's not uncommon to find little pools of rainwater in these little "mushroom bowls".


Observations

July 13th, 2023 Indian Cave State Park
Purple-bloom Russula (Russula sp-IN22)

#198

  • Growing solitarily in open mixed oak/hickory woodland near edge.

  • Nearby Trees: Chinkapin Oak, Shagbark Hickory, Northern Red Oak, Bur Oak, Black Oak, distant Elm and Black Walnut.

  • Smell: Unique, and pleasant, almost floral.

  • Taste: Pleasant.

  • KOH: Orange on pileipellis, light orange on trama, lighter orange on hill face, and turning the red on stipe to light orange.

DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTATAACCGAGGTGCTAGGGCTGTCGCTGACCCTTTGAAGGGTCGTGCACGCCCAAGTACTCTCTCACATCCATCTCACCCCCTTTGTGCATCATCGCGTGGGCTACCTTTTTGGCTTGTTCCAAGAAGGTTGGTTCGCGTTTTTACACACACCCACACCTTTATGTATAGAATGTCTTACTTTTTGCGGTCATACGCAATAAATAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAACACATCCTCAACCTTCTTTTGGTTTTTTTGACCAGGGAAGGCTTGGACTTTGGAGGTCTTTCATTGCTGGTATCCTTTCAAAGCCAGCTCCTCCTAAATGAATCAGTGGGGTCCACTTTGCTGATCCTTGACGTGATAAGTATTATTCTACGTCTCGGGTTTTCGCAGTGTCACCGTGGAACCTGCTTCGAACCGTCTTTGAACAAAGACAATGTTCGGGTTTCGACTCGAACCACAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAAG
View MycoMap DNA Results
Observation by thefungiproject

Created March 17, 2026 at 9:26 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.