Green Cracking Russula
Russula sp-IN162
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Russulales > Russulaceae > Russula
Description
The Green Cracking Russula (Russula sp-IN162) is a distinctive mycorrhizal mushroom that can be found in woodland settings in the summer. This one was found at Indian Cave State Park in eastern Nebraska growing from the soil near Ash, Chinkapin Oak, American Hophornbeam, Bur Oak, and Shagbark Hickory trees. There are other closely related species that share this morphology in Russula subsect. Virescentinae.
The cap is uniquely "green-cracked" and the cap leather will easily pull from the margin of the cap to 2/3 the distance to the center. The gills are close, cream to pink colored when fresh, and display a forking pattern close to the stem. The fruiting body is quite sturdy for a Russula.
Observations
July 24th, 2023 Indian Cave State Park

#230
- Growing gregariously in open mixed oak/hickory woodland.
- Nearby Trees: Ash, Chinkapin Oak, American Hophornbeam, Bur Oak, and Shagbark Hickory.
- Cap sturdy, green, cracking in patches, white to light tan beneath, with an inrolled margin. Pileipellis easily peeling 2/3 to the center from margin.
- Stipe sturdy and unchanging in color.
- Lamellae cream to pinkish, forking occasionally near apex of stipe.
- Smell: not distinctive.
- Taste: not distinctive.
- KOH: slowly pale orange on pileipellis.
- Ammonia slightly darkening pileipellis.
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTATAACAGAGATGCCCAGGGCTGTCGCTGACCTTCACAGGTCGTGCACGCCCAAATGTGCTCTCTTATGTCCATCTCACCCCTTTGTGCATCACCGCGTGTGCCCCCCCCTATTGGGCTTGTTCCAAAGGGGGCGGTTCACGTTTTAACACAGACACCAATTTTTAAGAGCATGTGTAGAATGTCTTACTTTTTGCGATTATGCGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAACACCCTCAACCTTCTTGGTTTCTTGACCAGGAAGGCTTGGACTTTGGAGGTTTTCCTTGCTGGCCTTCCTTTGAAGCCAGCTCCTCCTAAATGAATTAGTGGGGCTCGCTTTGCCGATCCTTGACGTGATAAGTATGCTTCTACGTCTTGGGTTTTGAACGAACCCGCTTCGAACGGTCTTTGAACAAAGACAACGTTCGAGTTGCATTGCGACTCGAGCACAGCGACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTView MycoMap DNA Results
Created April 21, 2025 at 7:29 PM and last updated April 21, 2025 at 7:29 PM