undefined (Russula sp-IN14)
undefined (Russula sp-IN14)
undefined (Russula sp-IN14)
undefined (Russula sp-IN14)
< Back to Home

Russula sp-IN14

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Russulales > Russulaceae > Russula


Description

Russula sp-IN14 is a large mycorrhizal mushroom that can be found in the summer in woodland settings. This one was found in an Oak/Hickory woodland at Indian Cave State Park. It was found growing from soil near Ash, Shagbark Hickory, Bur Oak, and American Hop Hornbeam trees. It has a slightly acrid aftertaste and the cap leather will pull easily from the margin to 1/3 distance to the cap center. The tan cap features subtle notes of green and maroon.


Observations

June 13th, 2023 Indian Cave State Park
Brittlegills (Russula sp-IN14)

103

Large. Variable tan with subtle notes of green and maroon. Growing in open mixed oak/hickory woodland edge near Ash, Shagbark Hickory, Bur Oak, and American Hop Hornbeam. Pileipellis tearing easily 1/3 to the center from the margin.

Ammonia: Pileipellis: flashing olive then turning lightly pale. Stipe: negative. KOH: Pileipellis: bright orange. Stipe: negative.

Taste: mild then slightly acrid.

DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTAAAAAAAGAGGTGCAAGGGCTGTCGCTGACCCTCAAAGGTCGTGCACGTCCAAGTGCTTCCACACAATCCATCTCACCCCTTTGTGCATCACCGCGTGGGTTCCTCCTTTGCGGGAAGGGCCTGCGTTTTTATCATAAAACTCAATACAGTGTAGAATGTTTATTTTTGCGGTCATACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAATGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATTCTCAAAAACCCTTTTCTTTGATCCTTTGTGGTCGGGAAAAGGATTTTTGGACTTGGAGGTTCAATGCTTGCTTTTGCTTTCGAGAGCGAGCTCCTCTCAAATAAATTAGTGGGGTCCGCTTTGCTGATCCTTGACGTGATAAGATGTTTCTACGTTTTGGATTTGGCACTGTCCTTTGGACGTCCGCTCCCAACTGTCCTATGGACGACGATGGTGCTTCGGTCACCGCCATCTACATTGGCGGGAGGCTGGACCCACAAAAAACCCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAAG
View MycoMap DNA Results
Observation by thefungiproject

Created June 26, 2025 at 10:30 AM and last updated June 26, 2025 at 10:30 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025