Russula sp-IN14
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Russulales > Russulaceae > Russula
Description
Russula sp-IN14 is a large mycorrhizal mushroom that can be found in the summer in woodland settings. This one was found in an Oak/Hickory woodland at Indian Cave State Park. It was found growing from soil near Ash, Shagbark Hickory, Bur Oak, and American Hop Hornbeam trees. It has a slightly acrid aftertaste and the cap leather will pull easily from the margin to 1/3 distance to the cap center. The tan cap features subtle notes of green and maroon.
Observations
June 13th, 2023 Indian Cave State Park

103
Large. Variable tan with subtle notes of green and maroon. Growing in open mixed oak/hickory woodland edge near Ash, Shagbark Hickory, Bur Oak, and American Hop Hornbeam. Pileipellis tearing easily 1/3 to the center from the margin.
Ammonia: Pileipellis: flashing olive then turning lightly pale. Stipe: negative. KOH: Pileipellis: bright orange. Stipe: negative.
Taste: mild then slightly acrid.
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTAAAAAAAGAGGTGCAAGGGCTGTCGCTGACCCTCAAAGGTCGTGCACGTCCAAGTGCTTCCACACAATCCATCTCACCCCTTTGTGCATCACCGCGTGGGTTCCTCCTTTGCGGGAAGGGCCTGCGTTTTTATCATAAAACTCAATACAGTGTAGAATGTTTATTTTTGCGGTCATACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAATGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATTCTCAAAAACCCTTTTCTTTGATCCTTTGTGGTCGGGAAAAGGATTTTTGGACTTGGAGGTTCAATGCTTGCTTTTGCTTTCGAGAGCGAGCTCCTCTCAAATAAATTAGTGGGGTCCGCTTTGCTGATCCTTGACGTGATAAGATGTTTCTACGTTTTGGATTTGGCACTGTCCTTTGGACGTCCGCTCCCAACTGTCCTATGGACGACGATGGTGCTTCGGTCACCGCCATCTACATTGGCGGGAGGCTGGACCCACAAAAAACCCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAAGView MycoMap DNA Results
Created June 26, 2025 at 10:30 AM and last updated June 26, 2025 at 10:30 AM