Russula michiganensis
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Russulales > Russulaceae > Russula
Description
Russula michiganensis is a mycorrhizal mushroom that can be found in the summer in Oak woodlands. This one was found in the Oak/Hickory woodlands of Indian Cave State Park in eastern Nebraska. It is an overall white-colored mushroom that stains black/gray where bruised.
The cap is evenly rounded and becomes deeply depressed with age. The gills are white, crowded, and broadly attached to the stem. The stem is sturdy. The taste is acrid. The spore print is white.
Observations
July 25th, 2023 Indian Cave State Park

#241
- Emerging from soil gregariously in bank near trail in open mixed oak/hickory woodland on northwest-facing slope.
- Cap white, sturdy with an inrolled margin, bruising black within minutes where handled.
- Stipe white, sturdy, bruising black within minutes where handled.
- Flesh white changing blackish where exposed.
- Smell: earthy (probably due to the copious amounts of dirt.
- Taste: mildly acrid.
- KOH: brownish on stipe.
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGGTACTACAGAGGCGTGAAGGTTGTCGCTGACCTTTCTGAAAGGTCGTGCACGCCGGAGCCGCTCTCACACAATCCACCTCACCACTTGTGCTTCACCGCGCGGGGTCTCCTTCGAGAGGGGGAGGCTCGCGTCTTTTTCACACACACACACACACAATATACAGTCTGGTAGTTTAGAATGTCAATCAATACAACTTTCAACAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCCTTGGTATTCCGAGGGGTACACCCGTTTGAGTGTCGTGAATTCCTCAAACCTTCTTGGTTTCTTGATCAAGAAGGCTTTGGACTTTGGAGGTCTTTGCCGGCTTTGCGAAAAGTCGGCTCCTCTTAAATGCATTAGTGGGGTCCCCTTTGCCGATCTCTAGGCGTTGATAATACGTTTCTACGTCTTGGGATTTGCTCTGTTCCTTGGGAATCCGCTTCTAACCGTCTCACCGTCGGAGACATCGTTCGAGCTTGCTCGACCCACGAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAAGView MycoMap DNA Results
References
Kuo, M. (2024, September). Russula michiganensis. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/russula_michiganensis.html
Created February 26, 2026 at 8:43 PM





