undefined (Russula michiganensis)
undefined (Russula michiganensis)
undefined (Russula michiganensis)
undefined (Russula michiganensis)
undefined (Russula michiganensis)
undefined (Russula michiganensis)
undefined (Russula michiganensis)
< Back to Home

Russula michiganensis

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Russulales > Russulaceae > Russula


Description

Russula michiganensis is a mycorrhizal mushroom that can be found in the summer in Oak woodlands. This one was found in the Oak/Hickory woodlands of Indian Cave State Park in eastern Nebraska. It is an overall white-colored mushroom that stains black/gray where bruised.

The cap is evenly rounded and becomes deeply depressed with age. The gills are white, crowded, and broadly attached to the stem. The stem is sturdy. The taste is acrid. The spore print is white.


Observations

July 25th, 2023 Indian Cave State Park
 (Russula michiganensis-IN01)

#241

  • Emerging from soil gregariously in bank near trail in open mixed oak/hickory woodland on northwest-facing slope.
  • Cap white, sturdy with an inrolled margin, bruising black within minutes where handled.
  • Stipe white, sturdy, bruising black within minutes where handled.
  • Flesh white changing blackish where exposed.
  • Smell: earthy (probably due to the copious amounts of dirt.
  • Taste: mildly acrid.
  • KOH: brownish on stipe.
DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGGTACTACAGAGGCGTGAAGGTTGTCGCTGACCTTTCTGAAAGGTCGTGCACGCCGGAGCCGCTCTCACACAATCCACCTCACCACTTGTGCTTCACCGCGCGGGGTCTCCTTCGAGAGGGGGAGGCTCGCGTCTTTTTCACACACACACACACACAATATACAGTCTGGTAGTTTAGAATGTCAATCAATACAACTTTCAACAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCCTTGGTATTCCGAGGGGTACACCCGTTTGAGTGTCGTGAATTCCTCAAACCTTCTTGGTTTCTTGATCAAGAAGGCTTTGGACTTTGGAGGTCTTTGCCGGCTTTGCGAAAAGTCGGCTCCTCTTAAATGCATTAGTGGGGTCCCCTTTGCCGATCTCTAGGCGTTGATAATACGTTTCTACGTCTTGGGATTTGCTCTGTTCCTTGGGAATCCGCTTCTAACCGTCTCACCGTCGGAGACATCGTTCGAGCTTGCTCGACCCACGAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAAG
View MycoMap DNA Results
Observation by thefungiproject

References

Kuo, M. (2024, September). Russula michiganensis. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/russula_michiganensis.html


Created March 17, 2026 at 9:26 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.