Hawaiian Coincap
Rhodocollybia laulaha
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Marasmiineae > Omphalotaceae > Rhodocollybia
Description
Rhodocollybia laulaha is a decomposer of wood and can be found in the summer through fall. The gills are extremely shallow (narrow), maze-like, and crowded. The spore print is white.
This mushroom was first described in Hawaii, and it was believed at the time that it was isolated to the Hawaiian islands. Recent DNA results have also placed this mushroom in Nebraska, Missouri, and Indiana. More research is needed to understand why, which makes this mushroom a subject of active research.
The name laulaha is the Hawaiian word for ‘common and widespread’. The name was meant to describe that it was endemic to the islands, though it is showing to have a disjunct range that includes the Midwest.
Observations
August 20th, 2024 Indian Cave State Park

AA34
- Growing on well-rotted hardwood log in small draw near mixed oak woodland edge.
- Spore Print: white or lightly colored.
July 5th, 2023 Indian Cave State Park

#155
Growing clustered on rotting hardwood log on well-shaded, north facing, mixed oak/hickory woodland slope.
Stipe elastic and hallow. Stipe increasing thickness at base. Clustering. Shallow gills. Cap surface brown-orange.
Smell: stipe phenolic; cap nutty Taste: phenolic, faint KOH: olive-gray on stipe and pileipellis, and honey colored on hymenium. (Later turning red on pileipellis)
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATTGAAAAAGAAAGAAAAGAGGGAGGTTGATGAAAGTGTTTTATGTCTGCATGTTGCTGGCCTTTGAAACAATAAGGCATGTGCACTGTTGATGCTCATCGACTGAACTTTTTTTTCTTTCTTTCTTCGCTTTTCATCCACCTGTGCACTTTTTGTAGAAGTTCTTGTTGTTGAGATGAGACTTCTATGTTCTTTACAAACTAAAAATGTTGAGAATGTGTTGTTATATTTTATTGGGACTTCATTGACCCATAAAAAATAAAAAAAAACCCTTTATACAACTTTCAGCAATGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTCTGGTATTCCGGAGGGTATGCCTGTTTGAGTGTCATTAACTTCTCAACTTCAAAAAGGTTTTCTTTTTTTGTTGTTTGGATGTGGAGGTTTTGCTGGTTATCTCGTTTGAGTTTCAGCTCCTCTTAAATGCATTAGTGGAGACTTATAACCCGTTGTGTTGATCCCATTTTGATGTGATAATTATCTACATTTTAGTGGTTTCAGCTTTGCTCTCAGAAATCTGATTTCTGGTTGAGAATATTGCAAGGATCTATCTTTGGCTTTATTCTGATAGTGGGTTGTATGTATGCGTCTGCTTTCTAACTGTAATCACCTTATTGATAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGView MycoMap DNA Results
References
Kalichman, J. (2023). Names - Agaricus & Agaricales. Retrieved January 17, 2025, from Agaric.us website: https://agaric.us/common_names/names.html
Keirle, M. (2009). The Mycological Society of San Francisco MycoDigest: Establishing Fungal Endemism: The Curious Distribution of Rhodocollybia laulaha. https://www.mssf.org/mycena-news/pdf/0902mn.pdf
Created September 20, 2026 at 1:53 PM












