undefined (Pseudosperma notodryinum)
undefined (Pseudosperma notodryinum)
undefined (Pseudosperma notodryinum)
undefined (Pseudosperma notodryinum)
undefined (Pseudosperma notodryinum)
undefined (Pseudosperma notodryinum)
undefined (Pseudosperma notodryinum)
undefined (Pseudosperma notodryinum)
undefined (Pseudosperma notodryinum)
undefined (Pseudosperma notodryinum)
< Back to Home

Pseudosperma notodryinum

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Agaricineae > Inocybaceae > Pseudosperma


Description

Pseudosperma notodryinum is a mycorrhizal mushroom that shows up in summer, usually July through August, in mixed forests with pine and oak (Zhang et al., 2022). It grows from the ground and blends in with the leaf litter, often going unnoticed. The cap is dry and yellow-brown to dark brown, with fine cracks or wrinkles across the surface — a feature called rivulose.

Caps start out cone-shaped and flatten with age, reaching about 3/4"-2" (2–4.5 cm) wide. Gills are closely spaced and transition from pale to tan or brownish with age. The stem is long and slender, with a slightly thicker base and a covering of fine white hairs that become fibrous over time. There’s no strong smell, which can separate it from other Inocyboid species. The spore print is brown.


Observations

July 13th, 2023 Indian Cave State Park
 (Pseudosperma notodryinum)

#195

  • Growing gregariously in open mixed oak/hickory woodland edge.

  • Nearby Trees: Black Oak, Bur Oak, Ash, Northern Red Oak, and distant Chinkapin Oak.

  • Lamellae light tan but discoloring yellowish in areas where damaged.

  • White basal mycelium.

  • Smell: Not distinctive.

  • Taste Not distinctive.

  • Spore print: Brown

DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAAACATGATAGGCTGTTGCTGGCTCTTTAGAGGAGCAAGTGCACGCTTGTCAACTTTATTTTATCCACCATGTGCACTGTTTGTAGATTCTAGAGAAACAATTATCTGACTGTTCAGATAGGTTGAGGACTGCTGCGTCTTTCAAAGCCAGCTTTGCCTTCTGTCTCTAGGGTCTATGTCACTCACATACACCTTATGAATGTAATAGAATGTTGACCTGGGTCTTTCAGTACCCATAAAAAGTTTAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATCAAATTCTCAACTACAATGATCTCTTCAGTGTAGCTTGGATTTGGGGGACTTTGGCTTTTGTGTATAAAGAAGTCAGCTCCCCTGAAATTGATTAGCGGTACCTTTGTAGACCATCTACAGGTGTGATAATTATCTGCACCCTTAGTTGTCTGAATGCTGCTTCCAGCTTTAACTTGTGACAATCTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject

References

Matheny, P. B., Hobbs, A. M., & Esteve-Raventós, F. (2019). Genera of Inocybaceae: New skin for the old ceremony. Mycologia, 112(1), 83–120. https://doi.org/10.1080/00275514.2019.1668906

Zhang, Z., Liu, J., & Yang, Z. (2022). New species of Mallocybe and Pseudosperma from North China. Journal of Fungi, 8(3), 256. https://doi.org/10.3390/jof8030256​


Created September 25, 2025 at 4:19 PM and last updated September 25, 2025 at 4:19 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025