Wooly Brittlestem (Psathyrella vinosofulva)
Wooly Brittlestem (Psathyrella vinosofulva)
Wooly Brittlestem (Psathyrella vinosofulva)
Wooly Brittlestem (Psathyrella vinosofulva)
Wooly Brittlestem (Psathyrella vinosofulva)
Wooly Brittlestem (Psathyrella vinosofulva)
Wooly Brittlestem (Psathyrella vinosofulva)
Wooly Brittlestem (Psathyrella vinosofulva)
< Back to Home

Wooly Brittlestem

Psathyrella vinosofulva

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Agaricineae > Psathyrellaceae > Psathyrella


Description

The Wooly Brittlestem (Psathyrella vinosofulva) is an uncommon decomposer of woody debris and can be found in the spring and summer. It enjoys growing on soil amongst well-decomposed wood (especially ash), distributed (but uncommon) across the Northern Hemisphere. These specimens were found in a low, shaded woody area adjacent to a creek.

Psathyrella vinosofulva resembles the more common Maroon Brittlestem except for its cap color is brighter reddish to brownish, is more slender, and possesses a great deal more wooly velar tissue on the top of the cap. The cap is shaped evenly rounded, sometimes with a small umbo in the center ornamented with distinctive wool-like groups of fibers that wear off with age. The gills are attached to the stem and not crowded. The stem is exceptionally brittle with no annulus but sometimes wooly velar tissue at the base (similar to that on cap surface). It has a blackish spore print.


Observations

September 12th, 2023 Indian Cave State Park
 (Psathyrella vinosofulva)

#395

  • Growing from woodland duff/soil near rotting hardwood log in low, moist woodland draw.
  • Caps purplish-brown with white scales when young, later turning brown and convex with a heavily striated margin.
  • Lamellae adnexed, marginate (lighter edge), with frequent partial gills.
  • Stipe equal, lighter colored near apex, with white basal mycelium.

Additional Details

  • Spore Print: blackish
DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATATCTATGGCGTTGGTTGTAGCTGGCTTTAAGGAGCATGTGCACACCCCGTCATTTTTATCTTTCCACCTGTGCACCCAATGTAGATCTGGATAACTCTCGCTTTTCGAAGCGGAAACAGAGATTGCTGCGTCGCAAGACCGGCTTTCTTTGAATTTCCAGGTCTATGTCTTTTACAAACCCCAATGAATGATAATGAATGTAATTGGGCTCTAAGCCTATAAAACAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTGTTATGAAACTGTGTAAGGCTTGGATGTGGGAGTTTGTGCTGGCTGCCTCAGTGCGGTCTGCTCTCCTGAAATACATTAGCGAGTTTATACTAGACTCCGTCTATTGGTGTGATAATTATCTACGCCGTGGATTGGGTTTAGACTTGCTTCTAACCGTCCGGAAGGACAATCTTTGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG
View DNA BLAST Results

References

Kuo, M. (2011, January). The genus Psathyrella. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/psathyrella.html

Psathyrella vinosofulva P.D. Orton, Transactions of the British Mycological Society 43 (2): 378 (1960) [MB#337699]

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Field Guide Download | About | Contact | © Fungi Project 2025