Scaly Shield (Pluteus petasatus)
Scaly Shield (Pluteus petasatus)
Scaly Shield (Pluteus petasatus)
Scaly Shield (Pluteus petasatus)
Scaly Shield (Pluteus petasatus)
< Back to Home

Scaly Shield

Pluteus petasatus

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Pluteineae > Pluteaceae > Pluteus


Description

The Scaly Shield (Pluteus petasatus) is a decomposer of wood is a decomposer of dead deciduous trees that can be found from spring through fall. It can sometimes be found growing from soil attached to buried wood or growing from wood chips or stumps in urban areas. It is widespread throughout North America growing alone or in small groups. This specimen was found growing from dead American Linden.

Pluteus petasatus has an evenly rounded to flat cap shape commonly with a small bump in the center (umbo). There are generally brown scales in the center of the cap, from which this mushroom gets its common name. The gills are free from the stem, generally white later into maturity (as compared to its closely related Pluteus cervinus), which later become pinkish with the development of pinkish brown spores. The stem generally has an enlarged base, without an annulus or volva. The spore print is brownish pink.


Observations

June 25th, 2023 Indian Cave State Park
Scaly Shield (Pluteus petasatus)

#124

Growing on the exposed rotting roots of large dead American Linden tree in the bottom of moist/shady draw dominated by pawpaw trees in woodland. Pileipellis slightly tacky. Taste: not distinctive.

DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATAAACAAGTGCAGGTTGTGCTGGCCTTCTTGGTATGTGCACGCCTGCCAATGTTTCATTCTATCTTCCCACCTGTGCACTATGTGTAGATCTGTATGCTATTGTCAAGTCTTTTACTAAGCTTGGTTGAGAGGAGTTGCTTGTTCCATTGGACAAGCTCTTCTTGGGTATGCAGGTCTATGTTTTATATCAACACCATATGAATGTAATAGAATGTGCTTTGGGCTTTTAGCCTTTAAAACATATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAATCCCCACAATCTTGTGTTGCTGGGTGATTGGATTTTGGGGGCTTGCTGGCCTTGTTCAGCTCTCCTTAAAAGCATTAGCAGGATATTATGCCATCTGTGCTTTGTATGATATATATCTATACATTGTACTTATTGTGCACAACTGCTTCCAACTGTCATCTGACATTTGACCAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject

References

Kuo, M. (2018, March). Pluteus petasatus. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/pluteus_petasatus.html

Pluteus petasatus (Fr.) Gillet, Les Hyménomycètes ou Description de tous les Champignons qui Croissent en France: 395 (1876) [MB#144854]


Created March 17, 2026 at 9:26 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.