Gilled Bolete (Phylloporus sp-NE01)
Gilled Bolete (Phylloporus sp-NE01)
Gilled Bolete (Phylloporus sp-NE01)
Gilled Bolete (Phylloporus sp-NE01)
Gilled Bolete (Phylloporus sp-NE01)
Gilled Bolete (Phylloporus sp-NE01)
Gilled Bolete (Phylloporus sp-NE01)
Gilled Bolete (Phylloporus sp-NE01)
< Back to Home

Gilled Bolete

Phylloporus sp-NE01

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Boletales > Boletaceae > Phylloporus


Description

Though mostly genetically similar to boletes, rather than having pores this mushroom has gills. Features like size, stature, and color might suggest that this is a ruby bolete until the underside of the cap is examined.

Similar in form to Phylloporus leucomycelinus.

Gills

July 31st, 2023 Field Notes - Indian Cave State Park:

Growing gregariously on east-facing open mixed oak/hickory woodland slope.

Nearby Trees: Chinkapin Oak, Northern Red Oak, and Ash.

  • Cap reddish-orange, subtomentose and not bruising where damaged.
  • Hymenium bright yellow with frequent short gills and cross-veins present.
  • Stipe reddish upper 1/2 to 2/3, tapering to a light yellow base.
  • Basal mycelium white.
  • Smell: not distinctive.
  • Taste: slightly acidic.
  • KOH: dark orange with darker outline on pileipellis.
  • Ammonia: quickly flashing green then darkening on pileipellis.

Observation

DNA Barcode ITS:

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAACAGAATAGAACAGGGCAGAGGGATTGTCGCTGGCGGGTCTTTCTCTCGCATGTGCACGTCCTTCTGCTTTTACTCTATTCACACTCTTAACACCTGTGCACTTTTTGTAGGTCCCCCTCTTCGAAAGAAGAGGGATCTAGGATCTATGTATTTATCATATCACCTCACATGTATGGCCAGAATGAAAACATAATAAAATAAAAATACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTCCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAGAATCAATCAACCATGCTTTCTTGACGGGAGAGCATGGCTTGGAGTTGGGGGTTGCTGGCGTTTCACCGTCAGCTCTCCTTAAATGCATTAGCGATCGAGTCGGGCTGGTCTTTCGACGTGCACGGCCTTGGACGTGATAAAGATCGTCCTGGGCTGGAGCGTTTGGTCGGCATGACATAGATCGATCGCGAAAGATATGGGAGGGGGGGAAGGTGATGGCGATGTGATCGGTCTGGTTGGAGCTTAGAGCTACTAGGCAGTCTTGAGAGAGGCTGGCGAAAACCGAGCGAAAGACAGATCGAGCTCAGAGCTTGAGCTTGAGCTTTCCTAATCGAAAAAGAAAAGATGGGGGAAGGGGATGGCGATGTGATCTGTCCGGCGGAGCTTTAGCTACTAGGCAGTCTTGAGAGAGGCTGGCGAAAACTGGAGCAAAGACGGACGGTGATCGGAGCTTGAGCTTTCCTTTGTTTGATCTTGGACCTGTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG


References

Kuo, M. (20035 March). The genus Phylloporus. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/phylloporus.html

Pavelle, S. (2015b, July 24). Phylloporus leucomycelinus (“Gilled Bolete”). The Bolete Filter. https://boletes.wpamushroomclub.org/product/phylloporus-leucomycelinus-rhodoxanthus/


Created March 17, 2026 at 9:26 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.