undefined (Phallogaster cf. phillipsii)
undefined (Phallogaster cf. phillipsii)
undefined (Phallogaster cf. phillipsii)
undefined (Phallogaster cf. phillipsii)
undefined (Phallogaster cf. phillipsii)
undefined (Phallogaster cf. phillipsii)
undefined (Phallogaster cf. phillipsii)
undefined (Phallogaster cf. phillipsii)
undefined (Phallogaster cf. phillipsii)
undefined (Phallogaster cf. phillipsii)
undefined (Phallogaster cf. phillipsii)
undefined (Phallogaster cf. phillipsii)
undefined (Phallogaster cf. phillipsii)
undefined (Phallogaster cf. phillipsii)
undefined (Phallogaster cf. phillipsii)
undefined (Phallogaster cf. phillipsii)
undefined (Phallogaster cf. phillipsii)
< Back to Home

Phallogaster cf. phillipsii

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Phallomycetidae > Hysterangiales > Phallogastrineae > Phallogastraceae > Phallogaster


Description

What a bizarre gasteroid-stinkhorn spectacle of a fungus! The outer tissue (peridium) is white and turns pink when handled. The inside (gleba) is fascinating: Gelatinous, with zones of both clear and greenish tissue (the spore producing tissue) make a brilliant pattern in cross-section. So striking... almost as if the observer can imagine as if they are peering into underwater clouds in a jelly, cave-like pool.

This specimen was found in a spring branch canyon in the Niobrara Valley preserve.

Phallogaster cf. phillipsii (==Phallogaster sp-PA01) is a North American sister taxa to Phallogaster saccatus.

DNA August 24, 2026


Observations

June 18th, 2025 Niobrara Valley Preserve
 (Phallogaster)

AB89

Growing under hardwood log, loosely attached to substrate via rhizomorphs, in large spring branch canyon.

DNA Barcode ITS:
CCTGTTTAAATGCATGTCTAATGGTTCTACGGAGCCAAAACATAATACAACTTTCAACAACGGATCTCTTGGCTTTCGCATCGATGAAGAACGCCGCGAAAGTGCGAAACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCGTGAAGTCTCTCGACTCTTACCTTTGTTAAAAGGGTGAGAGGTCGGATTTGGACGCTGCTGCGCTTCGGTGTGGCTCGTCTCTAAATGCATTAGCTGTTTCCGCCTCGGTCTACGAATAACGGTGTGATAAGAAATGACTTGCGCCGCGATCGTTACGGGAAGGGATGGCTTACAATCGTCCCCTCGGGACAAACTCTACGTCATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTGTAATCTGGCGGTCTAAGGCCGTCCGA

Observation by thefungiproject

Created August 24, 2026 at 4:56 PM