Perenniporia ohiensis
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Polyporales > Polyporaceae > Perenniporia
Description
Perenniporia ohiensis is a common small conk that can be found year-round. It grows on the dead wood of broadleaf trees and is commonly found on fence posts. It's distinguishable by its small size and round pores. The cap turns from cream-colored to black with age. The cap will turn reddish with the application dilute KOH (potassium hydroxide).
June 20th, 2023 Field Notes - Indian Cave State Park:
- Growing on old wooden fence post (presumably Osage Orange) in mixed oak/hickory woodland.
- KOH on top of cap reddish-brown, darker brown on inner flesh, and orangish on hymenium.
DNA Barcode ITS:
GAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAAATCTTCAACCTGTAGTCCTTTGCGATCTATAGGCTTGGACTTGGAGGCTTGTCGGTGTAGTGCCGGCTCCTCTTAAATACATTAGCTTGATTCCTTGCGGATTGGCTGTTGGTGTGATAATTGTTTACGCCGCGACCATGAAGCGTTTGGCGAGCTTCTAATCGTCTTGTAAGAGACATTGTTATGACCTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA
May 13th, 2024 Field Notes - Fontenelle Forest:
- Growing on rotting hardwood log in low spring fed oak woodland draw.
- Hymenophore comprised of small, well-spaced, circular pores.
June 16th, 2024 Field Notes - Niobrara Valley Preserve:
Spore Print: whitish
June 17th, 2024 Field Notes - Niobrara Valley Preserve:
References
Kuo, M. (2007, March). Perenniporia ohiensis. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/perenniporia_ohiensis.html
Created September 9, 2026 at 1:34 PM

























