Perenniporia ohiensis is a common small conk that can be found year-round. It grows on the dead wood of broadleaf trees and is commonly found on fence posts. It's distinguishable by its small size and round pores. The cap turns from cream-colored to black with age. The cap will turn reddish with the application dilute KOH (potassium hydroxide).

June 20th, 2023 Field Notes - Indian Cave State Park:

• Growing on old wooden fence post (presumably Osage Orange) in mixed oak/hickory woodland.
• KOH on top of cap reddish-brown, darker brown on inner flesh, and orangish on hymenium.

DNA Barcode ITS:

GAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAAATCTTCAACCTGTAGTCCTTTGCGATCTATAGGCTTGGACTTGGAGGCTTGTCGGTGTAGTGCCGGCTCCTCTTAAATACATTAGCTTGATTCCTTGCGGATTGGCTGTTGGTGTGATAATTGTTTACGCCGCGACCATGAAGCGTTTGGCGAGCTTCTAATCGTCTTGTAAGAGACATTGTTATGACCTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA

May 13th, 2024 Field Notes - Fontenelle Forest:

• Growing on rotting hardwood log in low spring fed oak woodland draw.
• Hymenophore comprised of small, well-spaced, circular pores.

June 16th, 2024 Field Notes - Niobrara Valley Preserve:

Spore Print: whitish

June 17th, 2024 Field Notes - Niobrara Valley Preserve: