Antilles Mottlegill (Panaeolus antillarum)
Antilles Mottlegill (Panaeolus antillarum)
Antilles Mottlegill (Panaeolus antillarum)
Antilles Mottlegill (Panaeolus antillarum)
Antilles Mottlegill (Panaeolus antillarum)
Antilles Mottlegill (Panaeolus antillarum)
Antilles Mottlegill (Panaeolus antillarum)
Antilles Mottlegill (Panaeolus antillarum)
Antilles Mottlegill (Panaeolus antillarum)
Antilles Mottlegill (Panaeolus antillarum)
Antilles Mottlegill (Panaeolus antillarum)
< Back to Home

Antilles Mottlegill

Panaeolus antillarum

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Agaricineae > Galeropsidaceae > Panaeolus


Description

The Antilles Mottlegill (Panaeolus antillarum) is a widely distributed dung decomposer that can be found in the spring through fall. It can be found on a wide variety of herbivore dung, from those of horses, cows, buffalo, and elephant to name a few. The name is associated with where it was first described: in the Antilles archipelago bordered by the Caribbean Sea.

The cap is evenly rounded to bullet-shaped to bell-shaped, and colored gray to brown to white. The gills are distinctively "mottled" (two toned speckled, like granite stone), gray when young becoming black with age, and attached to the stem. The spore print is black. The stem has a constant width (even) has no annulus nor a volva.


Observations

July 17th, 2023 Indian Cave State Park
 (Panaeolus antillarum)

#214

  • Growing gregariously on horse dung in mixed oak/hickory woodland edge.
  • Mature caps slightly tacky with brown blotches near the center, while young caps viscid and more brown overall.
  • Gills marginate: white on edges and mottled gray on the faces, serrated, and attached to stem at apex.
  • Stipe long and sturdy, bruising lightly brown where handled, no bluing.
  • Smell: Not distinctive.
  • Taste: Similar to raw button mushrooms.
DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAATAAACTAGGTGGGTTGTTGCTGTCCCTCTCGGGGGAATTGTGCACGCCTTACCTTTTTTGTTTTTCCACCTGTGCACACACTGTAGGTCTGGAGGGAAAGGGAGGCAACTCCCTAACGTTTCAGGTCCTATGTTTTTTACACATACACTATGAAAAGTAACAGAACGACTCAATGGGCTTTGAGCCTATAAACTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGACGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCATCACTTTTTGTGATGATGGCTTGGATGTGGAGGTTTTTTTTGCAGGCCGTTAAGGTCAGCTCCTCTCAAATGAATTAGTAGGTGCCCCGCGCAAACCTATCTATTGGTGTGATAATTATCTACGCCGTGGATATTAGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACCGTCCTTTTTGGACAACTTGAACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject

References

Hallock, R. M. (2019). A Mushroom Word Guide. Independently Published.

Kuo, M. (2007, December). The genus Panaeolus. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/panaeolus.html

Panaeolus antillarum (Fr.) Dennis, Kew Bulletin 15 (1): 124 (1961) [MB#335553]


Created March 25, 2025 at 4:28 PM and last updated March 25, 2025 at 4:28 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025