Glasscup (Orbilia xanthostigma)
Glasscup (Orbilia xanthostigma)
Glasscup (Orbilia xanthostigma)
Glasscup (Orbilia xanthostigma)
Glasscup (Orbilia xanthostigma)
Glasscup (Orbilia xanthostigma)
Glasscup (Orbilia xanthostigma)
Glasscup (Orbilia xanthostigma)
Glasscup (Orbilia xanthostigma)
Glasscup (Orbilia xanthostigma)
< Back to Home

Glasscup

Orbilia xanthostigma

Life > Fungi > Ascomycota > Pezizomycotina > Orbiliomycetes > Orbiliomycetidae > Orbiliales > Arthrobotryaceae > Orbilia


Description

The Glasscup (Orbilia xanthostigma) is a disc fungi and decomposer of wood that can be found from spring through fall. The cup is yellow to ochre-colored, round in outline, semi-transparent, and with a waxy texture. The cups are small (up to 1/8") and can grow in large groups on downed logs.


Observations

August 31st, 2023 Indian Cave State Park
Glasscup (Orbilia xanthostigma)

#352

  • Growing in high numbers in close proximity on fallen hardwood log in low/moist, shaded woodland area.

Observation by thefungiproject
June 28th, 2023 Indian Cave State Park
Glasscup (Orbilia xanthostigma)

#135

Growing in large numbers in close proximity on large rotting (white rot) basswood log in the bottom of large, moist woodland draw.

DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAAAAAAAGAGGGAAGCCGGGCTCCTCCTGCCAGTCCCGGCACGTTTGCCCTGGCTCCGGCCGGCAGCGCAAACTCCAACCTCATGTGAAATCTCCAACTCCTTTCGCTTCGGCAGCAGGCTGGGCCCCGGTTGGGCCCTGCCCGTAAGCCTGCCGGCAGCACCGGCAAAAAACTCAGTTATCATCAACACAAAGTCTGACACCATTCTTGACCGAATGAAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAACGCGATAGTTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCGCCGGTAGTCCGGCGGGCACGTCTGTCTGAGCGTCTATGTCAAACACTTCGGCATGGAGCTGTGGCTCCATTGCGTGCCGGTCTTGGGCTTGTGTGAAGGGGCGGTCCCCATTTGTGGGGACTGCCTCCGTACGGTTGCCGACCTGGCCCGAGCCCCAAAATGTAAAAGCTAGGCGGTACGATGGTCGTCCACGGTCGTTCAGTATATGTTTCTTTCAAACGCTGTCGTGCCTGGGGGTCATGCCTGGCCGCCTCAAAGCCAAACTTGAAGTTTGACCTCAGATCAGATGAGGATACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject

References

Fries, Elias. (1846). Eliae Fries Summa vegetabilium Scandinaviae, seu Enumeratio systematica et critica plantarum quum cotyledonearum, tum nemearum inter Mare Occidentale et Album, inter Eidoram et Nordkap, hactenus lectarum, indicata simul distributione geographica ... Accedunt expositio systematis plantarrum morphologici, comparatio vegetationis adjacentium regionum, definitiones specierum in Kochii Synopsi florae germanicae et nemearum monographiis haud obviarum L. aliter expositarum (Vol. 2, p. 357). A. Bonnier. https://www.biodiversitylibrary.org/page/32636978


Created June 26, 2025 at 10:30 AM and last updated June 26, 2025 at 10:30 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025