undefined (Metuloidea reniformis)
undefined (Metuloidea reniformis)
undefined (Metuloidea reniformis)
undefined (Metuloidea reniformis)
undefined (Metuloidea reniformis)
undefined (Metuloidea reniformis)
undefined (Metuloidea reniformis)
undefined (Metuloidea reniformis)
undefined (Metuloidea reniformis)
< Back to Home

Metuloidea reniformis

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Polyporales > Meruliaceae > Metuloidea


Description

Metuloidea reniformis is a decomposer of wood and can be found in groups from February through October. Named in 2021, older literature may reference species matching this morphology as Steccherinum reniforme, Steccerinum rawakense, or Steccerinum subrawakense.

The cap is thin and is attached to wood without a stem (sessile). Generally colored brown with zones of different color, though it can fade with age to be whitish with or without zones. The surface under the cap in young specimens can look like fine, reptilian scales (which are densely crowded teeth), which later grow into distinguishable tooth-like structures with age.

Hymenophore1

Hymenophore2

June 27th, 2023 Field Notes - Indian Cave State Park:

Additional photos found a day later in the same area and added to observation.

Growing gregariously in clustered on a rotting hardwood log in low mixed oak/hickory woodland slope. Flesh tough/leathery.

Smell: Faintly pleasant. Mealy, like oatmeal.

KOH: Organish-brown on cap surface and slightly yellow on hymenium.

DNA Barcode ITS: AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATGAACTTGGGCAAAGCTGTCGCTGGCCTCAGCAATGGGGCATGTGCACGCTTTGTTCATCCACCTTCACACCTCTGTGCACTTCTCATGGGTTGGGTTGCGCTAGTAAAATAGCAAAGCCCTTCTCATGTGTTTACATCACATACTACAAAGTTTTTAGAATGTTACAATCATGCGTCAATGCATATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATTCTCAACCCTCCTGCATTTTTTTTGCAGTTGGGCTTGGACTTGGAGGTTTTTTTGCTGGTGGTCAAACCTTGTGTTTGAACGCGGGCTCCTCTGAAAAGCATTAGCTGGAATATTACTGAGCACGTTTCAATGTGATAATTGTCTACGTTGCTACGTCTCGGTATTAAATGTGTTTCAGCTTCAAACCGTCCCTTGCGGACAATATATCTGAACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG

Observation


References

Bessette, A. E., Smith, D. G., & Bessette, A. R. (2021). Polypores and similar fungi of eastern and central North America : a resource guide (p. 321). University Of Texas Press.

Westphalen, M. C., Motato-Vásquez, V., Tomšovský, M., & Gugliotta, A. M. (2021). Additions to the knowledge of hydnoid Steccherinaceae: Cabalodontia, Etheirodon, Metuloidea, and Steccherinum. Mycologia, 113(4), 791–806. https://doi.org/10.1080/00275514.2021.1894536


Created September 25, 2025 at 4:19 PM and last updated September 25, 2025 at 4:19 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025