Black-Staining Polypore (Meripilus sumstinei)
Black-Staining Polypore (Meripilus sumstinei)
Black-Staining Polypore (Meripilus sumstinei)
Black-Staining Polypore (Meripilus sumstinei)
Black-Staining Polypore (Meripilus sumstinei)
< Back to Home

Black-Staining Polypore

Meripilus sumstinei

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Polyporales > Meripilaceae > Meripilus


Description

The Black-staining Polypore (Meripilus sumstinei) is a parasite and decomposer of broadleaf trees and fruits in the summer and fall. It is often mistaken for Chicken of the Woods Laetiporus, though it can be distinguished by its black-staining nature and has much smaller pores. It grows in large clusters of rosettes at the base of broadleaf trees.

The black-staining can commonly be observed on the rosette margins and wherever it is bruised. The white pore surface underneath features tiny pores. The flesh is white and stringy. The spore print is white.


Observations

June 27th, 2023 Indian Cave State Park
Black-staining Polypore (Meripilus sumstinei)

130

3 rosettes growing at/near the base of a large standing, dead, charred, Northern Red Oak on north facing Oak woodland slope. Outer margins darken to black. Flesh white and fibrous.

DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATTCCAAACTTGGGTGAGGTTGTTGCTGGCCCCTTGGGGTATGTGCACATCTTGCTCATTCATTCCTTATACCTCTGTGCACCTTTCATAGGATGGCTTGCGGCTGCTGGCCTTTGTGCCAATGGTTCTGCAGCTGTTCTGTGTTTTTACAAACCTTTGAATCAGTTTTGAATGTTTATCGTGCATATGCACATTTAAATTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATTCTCAATTCACCTTAATTTTGAGGTGGCATTGGATTTGGAGGACATCTGCTGGCGGCGCCAGCTCCTCTTAAAGATATTAGTGTGAATGCTCACTTCATGCTCAGTGTGATAATTATCTTGCATTGTGCTTGGGTGTGGCGGCTTCATGCTTCCAACCGTCGCAAGACAACCTCTTGACAATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject

References

Kuo, M. (2010, March). Meripilus sumstinei. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/meripilus_sumstinei.html


Created February 26, 2026 at 8:43 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.