Orange Pinwheel (Marasmius siccus)
Orange Pinwheel (Marasmius siccus)
Orange Pinwheel (Marasmius siccus)
Orange Pinwheel (Marasmius siccus)
Orange Pinwheel (Marasmius siccus)
Orange Pinwheel (Marasmius siccus)
Orange Pinwheel (Marasmius siccus)
< Back to Home

Orange Pinwheel

Marasmius siccus

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Marasmiineae > Marasmiaceae > Marasmius


Description

The Orange Pinwheel (Marasmius siccus) is a small decomposer that can be found in duff and leaf litter from summer through fall east of the Rocky Mountains.

The cap is pleated and shaped like a pinwheel. The gills are white and distant. The stems of Marasmius mushrooms are elastic. This one has a dark to black stem and white basal mycelium at the point of attachment to the substrate.


Observations

July 6th, 2023 Indian Cave State Park
Orange Pinwheel (Marasmius siccus)

#159

Growing gregariously (abundant) among oak woodland duff in low riparian woodland area near creek. Oak trees on slope above.

Smell: faintly foul KOH: pileipellis: dull yellow (spicy or dijon mustard yellow) white mycelium; stipe: darkens black, whitens the orange. Taste: “mushroomy phenolic aging into the sensation of back pepper.

DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAACATTGTAAAGGGAGGTTGAGCTGGCTCTTCACGAGCATGTGCTCACTTTTCTTTCAATCTTCATCCACCTGTGCACTTTTTGTAGAGAGTTTGAGAAATGGGCCTAGGTCCAAAGTATCGGGCTTTCTATGTTTTACAAACTCTGAACGTATGTCTTTGAATGTCATTTACAAGGTGCTTAATTGAACCTTTTAAAAACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTCTTGGTATTCCGAGAGGCATGCCTGTTTGAGCGTCATTAAATTCTCAACCTCAAAAGCTTTTTGTTTCTGAGGCTTGGATGTGGAGGTTTTGCCGGCTCTTTAAGAGTCAGCTCCTCTTAAATGCATTAGTGGAAACCGCTTGTAGTCCGCATTGGTGTGATAATTATCTACGCTATTGTTGGCTACAGCTCTGAGGTGTTCGTTTAGGGAAGTGCATTAGTTTGCTCTTTCTGTTTACATGACCCACAGAGTTGGCATCTGCTTCGAACCGTCCTAAGTTACTGGACAATACTTGACTATTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject

References

Kuo, M. (2012, December). Marasmius siccus. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/marasmius_siccus.html

Marasmius fulvoferrugineus Gilliam, Mycotaxon 4 (1): 82 (1976) [MB#317296]


Created May 19, 2025 at 9:31 PM and last updated May 19, 2025 at 9:31 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025