undefined (Lycoperdon sp-NY02)
undefined (Lycoperdon sp-NY02)
undefined (Lycoperdon sp-NY02)
< Back to Home

Lycoperdon sp-NY02

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Lycoperdaceae > Lycoperdon


Description

Lycoperdon sp-NY02 is a decomposer that grows in the summer and fall in woodland settings under broadleaf trees and conifers. These were found fruiting in large numbers along an Oak/Hickory trail (Trail 2) at Indian Cave State Park in southeastern Nebraska.

This mushroom is gasteroid. Meaning it produces spores inside the fruiting body. When mature, a pore on the top opens and releases the spores in great numbers when hit by rain, wind, and forest elements. This species produces copious amounts of easily removable, soft white scales that unavoidably cover the mycologist's hand when inspected. The inside of the fruiting body is white when young, later turning brownish as the spores mature. The spores are olive brown.

This mushroom is similar in form to Lycoperdon marginatum.


Observations

September 27th, 2023 Indian Cave State Park
 (Lycoperdon sp-NY02)

425

habitat: Terrestrial (on soil) [1] growth habit: Gregarious (growing as a group) to Scattered (1-2 feet apart)

Cap: shape: spathulate (spathula) to petaloid (petal-shaped); texture: scurfy, branny furfuraceous (like dandruff) to pulverulent (medium fine powder) to velvety, velutinous (short, soft) to strigose (log, coarse)

Stem: location: central; shape: terete (round) to tapering

[1] Growing from soil in mixed oak hickory woodland edge

DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATATTCTTGATGGGTTGTAGCTGGCTCTCCGGAGCATGTGCACACTTGTCTTGACTTTATTCGTCCACCTGTGCACCTTTTGTAGTCTTGGGGGTTAAGAGCAGTCGACTATCGGATGGCTATGGCCTTTCCGGACGTGAGGATTGCTGAGTGCGAAAGCATACAGCTCTTCTCTAATGACTTCTCCCTCGAGTACTATGTATTCATATACCACATAGTATGTTGTAGAATGTGATCAATGGGCCTATGTGCCTATAATAATGAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCCTCCAGCTTTTGCGAGTTGTGATGGGGCTTGGATCTGGGAGTTTGCGGGTCTTTATCAATGAAGGTCAGCTCTCCTGAAATGCATTAGCGGAACCGTTTGCAGTCCCGTCACTAGTGTGATAATTATCTACACTGTGATGATTGCTCTCTGACTAGTTCAGCTGCTAATCGTCCACTACGGACAACACTTAATGAACTTCTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG
View MycoMap DNA Results
Observation by thefungiproject

References

Kuo, M. (2019, February). Lycoperdon marginatum. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/lycoperdon_marginatum.html


Created April 22, 2025 at 2:04 PM and last updated April 22, 2025 at 2:04 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025