Lycoperdon sp-NY02
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Lycoperdaceae > Lycoperdon
Description
Lycoperdon sp-NY02 is a decomposer that grows in the summer and fall in woodland settings under broadleaf trees and conifers. These were found fruiting in large numbers along an Oak/Hickory trail (Trail 2) at Indian Cave State Park in southeastern Nebraska.
This mushroom is gasteroid. Meaning it produces spores inside the fruiting body. When mature, a pore on the top opens and releases the spores in great numbers when hit by rain, wind, and forest elements. This species produces copious amounts of easily removable, soft white scales that unavoidably cover the mycologist's hand when inspected. The inside of the fruiting body is white when young, later turning brownish as the spores mature. The spores are olive brown.
This mushroom is similar in form to Lycoperdon marginatum.
Observations
September 27th, 2023 Indian Cave State Park

425
habitat: Terrestrial (on soil) [1] growth habit: Gregarious (growing as a group) to Scattered (1-2 feet apart)
Cap: shape: spathulate (spathula) to petaloid (petal-shaped); texture: scurfy, branny furfuraceous (like dandruff) to pulverulent (medium fine powder) to velvety, velutinous (short, soft) to strigose (log, coarse)
Stem: location: central; shape: terete (round) to tapering
[1] Growing from soil in mixed oak hickory woodland edge
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATATTCTTGATGGGTTGTAGCTGGCTCTCCGGAGCATGTGCACACTTGTCTTGACTTTATTCGTCCACCTGTGCACCTTTTGTAGTCTTGGGGGTTAAGAGCAGTCGACTATCGGATGGCTATGGCCTTTCCGGACGTGAGGATTGCTGAGTGCGAAAGCATACAGCTCTTCTCTAATGACTTCTCCCTCGAGTACTATGTATTCATATACCACATAGTATGTTGTAGAATGTGATCAATGGGCCTATGTGCCTATAATAATGAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCCTCCAGCTTTTGCGAGTTGTGATGGGGCTTGGATCTGGGAGTTTGCGGGTCTTTATCAATGAAGGTCAGCTCTCCTGAAATGCATTAGCGGAACCGTTTGCAGTCCCGTCACTAGTGTGATAATTATCTACACTGTGATGATTGCTCTCTGACTAGTTCAGCTGCTAATCGTCCACTACGGACAACACTTAATGAACTTCTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGView MycoMap DNA Results
References
Kuo, M. (2019, February). Lycoperdon marginatum. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/lycoperdon_marginatum.html
Created February 26, 2026 at 8:43 PM

