Shield Dapperling (Lepiota clypeolaria)
Shield Dapperling (Lepiota clypeolaria)
Shield Dapperling (Lepiota clypeolaria)
Shield Dapperling (Lepiota clypeolaria)
Shield Dapperling (Lepiota clypeolaria)
Shield Dapperling (Lepiota clypeolaria)
Shield Dapperling (Lepiota clypeolaria)
< Back to Home

Shield Dapperling

Lepiota clypeolaria

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Agaricineae > Agaricaceae > Lepiota


Description

The Shield Dapperling (Lepiota clypeolaria) is a decomposer that can be found under conifer trees in the summer. This one was found growing under Eastern Red Cedar at Indian Cave State Park in southeastern Nebraska. It can be found growing alone or in small groups in soil, presumably decomposing conifer tree debris.

The cap is adorned with soft yellow scales, and the scales split more readily towards the margin to reveal a white under surface. The gills are white and free from the stem. The stem is white to yellowish with fluffy veil material attached to all surface besides the apex. The taste is nutty - please don't eat Lepiotas... spit it out after a taste! Members of this genus are known to contain deadly toxins. The spore print is white.


Observations

August 15th, 2023 Indian Cave State Park
Shield Dapperling (Lepiota clypeolaria)

#300

  • Growing in pair partially attached at the base of Eastern Red Cedar on the edge of thin mixed oak woodland.
  • Caps light orange, conical with splitting fibers near the margin (white underneath) with veil remnants on margin.
  • Lamellae white, discoloring orangish where damaged by insects, not attached to stipe.
  • Stipe white at apex turning light orange going down, fuzzy especially in upper half.
  • Basal mycelium white, attached to duff.

Additional Info

  • Smell: not distinctive
  • Taste: pleasantly nutty
DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAACTATGGTGGGTTGTTGCTGGCTTCTTGAAGCATGTGCACACCTGCTGTCTTTATCTATCCCACTGTGCACCACTTGTAGTCTTGGAGGGATAGCGGGGTTCGAGCTCCCCTTCCAGGTCTATGTCTTTTCCACAGACGTTAAAGTATGTCATAGAATGTAATCAAAGGGCCTTTGTGCCTATAGAACTCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAATCCCTTCCAGTTCTTTATAAACTGGTTGTGGCTTGGATATTGGGGGTTTCTGCAGGCCTTGCTATGTTGAGGTCAGCTCCCCTAAAATACATTAGCAGAACTGTTTGCGGTCTGTCACTGGTGTGATAATTATCTGCACCAAGGCTGCTTTCTGTCTTGTTCAGCTTCTAACTGTCTTCTTGGACAACTATTGAACATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG
View MycoMap DNA Results
Observation by thefungiproject

Created August 25, 2025 at 9:43 AM and last updated August 25, 2025 at 9:43 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025