Jelly Babies (Leotia lubrica)
Jelly Babies (Leotia lubrica)
Jelly Babies (Leotia lubrica)
Jelly Babies (Leotia lubrica)
Jelly Babies (Leotia lubrica)
< Back to Home

Jelly Babies

Leotia lubrica

Life > Fungi > Ascomycota > Pezizomycotina > Leotiomycetes > Leotiales > Leotiaceae > Leotia


Description

Jelly Babies (Leotia lubrica) can be found in soil around broadleaf trees or conifers, but sometimes on decomposing wood. The season ranges from late spring through fall. It is also known as "Ochre Jelly Club".


Observations

July 26th, 2023 Indian Cave State Park
Ochre Jelly Club (Leotia lubrica)

263

Growing clustered from soil in well-shaded, North-facing mixed Oak/Hickory woodland slope near creek.

  • Nearby Trees: American Hophornbeam, Hackberry, American Linden, Northern Red Oak, and Red Mulberry.
  • Cap irregular shaped with a slight depression above where the stipe attaches.
  • Stipe flattened in places and with scales especially near the apex.

Additional Info

  • Smell: not distinctive
  • Taste: mildly acrid to not distinctive.
  • KOH: darkening surfaces with a greenish outline.
DNA Barcode ITS:
GAACGCACATTGCACCCTCTGGCACCCAGGGGGTATGCCTGTCCGAGCGTCGTCACGACCCTCGAGCTCCCCGGAGCTCGGCGTTGGGTGCGGCCCCGATCACCGGGGCCCTCCCCAAAACCAGTGGCGGCCGTGGCCCGGTCCCGAGCGCAGTAGACTTCTCTCGCTCAGGGGCCTGGGCGGCGTGCCGGCCAGCAAGACTTCAGCCACACCAAAGGTTGACCTCGGATCAGGTAGGAGCACCCGCTGAACTTAA

Observation by thefungiproject

Created March 17, 2026 at 9:26 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.