Clay-Gilled Milkcap (Lactarius argillaceifolius-IN02)
Clay-Gilled Milkcap (Lactarius argillaceifolius-IN02)
Clay-Gilled Milkcap (Lactarius argillaceifolius-IN02)
Clay-Gilled Milkcap (Lactarius argillaceifolius-IN02)
Clay-Gilled Milkcap (Lactarius argillaceifolius-IN02)
Clay-Gilled Milkcap (Lactarius argillaceifolius-IN02)
Clay-Gilled Milkcap (Lactarius argillaceifolius-IN02)
Clay-Gilled Milkcap (Lactarius argillaceifolius-IN02)
Clay-Gilled Milkcap (Lactarius argillaceifolius-IN02)
Clay-Gilled Milkcap (Lactarius argillaceifolius-IN02)
< Back to Home

Clay-Gilled Milkcap

Lactarius argillaceifolius-IN02

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Russulales > Russulaceae > Lactarius


Description

The Clay-Gilled Milkcap (Lactarius argillaceifolius) is a mycorrhizal mushroom that can be found growing on Oak forests in the summer. This one was found growing alone in low open mixed Oak/Hickory woodland near Northern Red Oak, Ash, and American Hophornbeam trees at Indian Cave State Park in southeastern Nebraska. It's well camouflaged in its environment and easily blends in with the surrounding leaf duff and woodland debris.

The cap is dull colored, flat to depressed in the middle and the surface is tacky, often adhering to leaves as if attached by glue. The gills are attached and running down the stem (decurrent) and are cream-colored becoming darker with age. The stem tapers at the base. When cut, it exudes a cream-colored latex, which later turns dark gray, producing the same color when the mushroom is bruised. The taste is peppery/spicy (acrid). The spore print is pale-yellow.


Observations

June 14th, 2023 Indian Cave State Park
Clay-gilled Milkcap (Lactarius argillaceifolius-IN02)

111

Lactarioid. Growing alone in low open mixed oak/hickory woodland near Northern Red Oak, Ash, American Hophornbeam trees.

  • Cap is tacky with woodland duff attached.

  • Latex cream-colored, later becoming dark gray.

  • Taste: mildly bitter, then acrid (spicy).

  • KOH yellowish-orange pileipellis and orangish on stipe.

  • Ammonia slightly olive on pileipellis.

  • Latex pale cream color initially, later staining the gills dark brown to black.

DNA Barcode ITS:
GAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCTGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTTCTGGACACCGAAGGAGGCTTGGACTTTGGAGGTCTCTGCTGGCATCTCTTGCCAGCTCCTCTCAAATGAATTAGCGGGGTCCTCTTTGCCGGTCCTTGACATGTGATAAGATGTTTCCATGTCTTGGTTCATGGCTCTGTTGCTTTTGGGACCTGCTTCTAACCGTCTCGATGACAATGTTTGAGTGTGTCTCCCTTCTCGGGAAAACACTCTCAAACCCACGAACCCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA
View MycoMap DNA Results
Observation by thefungiproject

References

Kuo, M. (2011, February). Lactarius argillaceifolius. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/lactarius_argillaceifolius.html


Created May 19, 2025 at 9:31 PM and last updated May 19, 2025 at 9:31 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025