Inocybe sp-NE02
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Agaricineae > Inocybaceae > Inocybe
Description
2024 DNA results of Inocybe sp-NE02 represent it as a new, undescribed species from Nebraska Oak/Hickory forests.
Members of this genus are known to be toxic. The toxin in question called muscarine. Please review the list of symptoms below.
The symptoms usually occur within 15-30 minutes of ingestion, and are focused on the involuntary nervous system. They include excessive salivation, sweating, tears, lactation (in pregnant women), plus severe vomiting and diarrhea. These symptoms may be accompanied by visual disturbances, irregular pulse, decreased blood pressure, and difficulty breathing. Victims normally recover within 24 hours, but severe cases may result in death due to respiratory failure. Atropine is a specific antidote, but must be administered by a physician. Dogs are particularly susceptible to the toxin muscarine. (Beug, 2024)
If you or someone you know has been poisoned by consuming wild mushrooms, call 9-1-1 and get the individual medical attention IMMEDIATELY. Afterwards, please report poisonings to the North American Mycological Association to contribute to our understanding of wild mushroom safety.
Observations
August 16th, 2023 Indian Cave State Park

314
Growing gregariously from and near moss patches on open mixed oak/hickory woodland.
Nearby trees: American Hop Hornbeam, Shagbark Hickory, Chinkapin Oak, Eastern Red Cedar, Black Walnut, and Ash.
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGTATAAACATGATAGGCTGTTGCTGGCTTTTTAGAGCAAGTGCACGCTTGTCGTCTTTATTTTTTCCACCATGTGCACTGTTTGTAGATCCTAGGGGGAAACATTTATCTGACCATTCAGATAGGTTGAGGACTGCTGCGTCTTTCAAAGCCAGCTTTGCCTTTCATCTCTGGGGTCTATGTCACTCATAATACACCTTACAATAGAATGTTGACCTGGGTCTTTTAGTACCCATAAAGTTTAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTACATTGATTTAGTGTAGCTTGGATTTGGAGGACTTTGGCTTTTGTACATCAAGTCAGCTCCCCTGAAATTGATTAGTGGTACCTTTGTAGACCATCTACAGGTGTGATAATTGTCTACGCCTCAGATGTCTGAATGGAACTGCTTATAACTTGAGTTTTTTGTACTCTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGView MycoMap DNA Results
References
Beug, M. (2024, April 23). Mushroom Poisoning Syndromes - North American Mycological Association. North American Mycological Association. https://namyco.org/interests/toxicology/mushroom-poisoning-syndromes/#muscarine
Created May 28, 2025 at 8:10 PM and last updated May 28, 2025 at 8:10 PM