Woodwax NY03
Hygrophorus sp-NY03
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Hygrophorineae > Hygrophoraceae > Hygrophorus
Description
Hygrophorus sp-NY03 was found in late fall growing among mosses at the edge of a mixed Oak woodland at Indian Cave State Park in eastern Nebraska. It was originally collected from New York. Nearby trees and shrubs included Northern Red Oak (Quercus rubra), Eastern Red Cedar (Juniperus virginiana), Black Oak (Quercus velutina), Roughleaf Dogwood (Cornus drummondii), and distant Chinkapin Oak (Quercus muehlenbergii).
Fruiting bodies were observed in mossy soil, but no detailed cap or gill coloration was recorded. The spore print is white.
Observations
December 4th, 2023 Indian Cave State Park
#499
-
Growing among mosses in mixed Oak woodland edge.
-
Nearby trees/shrubs: Northern Red Oak, Eastern Red Cedar, Black Oak, Roughleaf Dogwood, and distant Chinkapin Oak.
-
Spore Print: white
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATTTTGAAAAGAGGTTGTAGCTGATCGCAATAGATATGTGCACACCTCGTTCCAAATATTACACCATGTGCACTTTTTGTAGGCCAAGAAATTGGCCTATGTTTTTAATACACTCCAAAAGTTTAGAATGTTATTATCAATAAGCTTTGCTTATAAAAAATTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATCATCAATCCTTTAAAAAGGCTTTGGACTTTGGAGTTGCTGGCTTTGAGTTGGCTTCTCTTAAATGTATTAGCTTGTATCCTTTGCAGATAAGCTTTAGTTTGATAGATATCTACTATAGCTGTGAAGCAAATGTCAGCTTCCAATTATACAACTTTAAACTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTView MycoMap DNA Results
References
Hesler, L.R.; Smith, A.H. (1963). *North American Species of Hygrophorus*. University of Tennessee Press.
Created April 19, 2025 at 11:54 AM and last updated April 19, 2025 at 11:54 AM