Bitter Waxcap
Hygrocybe mucronella
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Hygrophorineae > Hygrocybaceae > Hygrocybe
Description
The Bitter Waxcap (Hygrocybe mucronella) can be found in grasslands and wooded areas summer through fall. The featured specimen was found growing a few inches in the entrances of small holes presumably dug by small animals. It can be found in eastern North America and Europe.
Observations
September 27th, 2023 Indian Cave State Park

423
habitat: Terrestrial (on soil)
growth habit: Gregarious (growing as a group)
Cap: shape: parabolic (half-egg) to convex (evenly rounded); texture: smooth to zonate to rugulose (with fine wrinkles) to hygrophanous (dark when wet; paler when dry); surface moisture texture: moist, lubricous, greasy; margin shape: straight; margin: entire, even, regular to crenate (scalloped)
Gills: attachment: decurrent to uncinate (with decurrent tooth); thickness: thick; spacing: subdistant; edges: even (entire) to marginate (different color) [1]; misc features: waxy (feeling like soft wax) to unequal (with short gills)
Stem: location: central; shape: terete (round) to flexuous to compressed (flattened); surface (same as cap plus): smooth to uneven (bumpy) [2]; texture: rigid to breaking with a snap to fragile to fibrous
[1] White margin
[2] Shiny, yellow to red
Found fruiting and small holes in the ground. Mixed o/h edge.
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAACGCTTGAGGATGTTGCTGGCCTTGAGTGGGCATGTGCACTCCTTGAACATTCCAACCTCACACCTGTGCACCTTTTGTAGGCTTGGCATAAACACAATGTCGGGCCTATGTATTTTTGCCTCACACACACCATTTGAATGTCATTTGAATGTCTTGTTATCGATGATAAATAATATACAACTTTCAACAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATTGAATCTTTGAACGCACCTTGCGCCCCTCGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTGAATTCTCAACTTGACCTGGGGGGGCTCTCCCTGGACGAGTCAAAGTTGGATTGTGGAGTTGTGCCGGTCACCTTTGGGCGACCGGCTCCTCTGAAAAGCATTAGCGAAAGGTCTCGAGCTAACCCTGGCATTGATAGTGTCATCTATGCCTCTGGTGAAGCCGATCGTACTTTGTTCGCTTCCAGCGGTCCCTCTTGGGACAAATCGAACGCACCTTTTACAATCACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGView MycoMap DNA Results
References
Fuljer, F., Zajac, M., Boertmann, D., Strašiftáková, D., Larsson, E., & Kautmanová, I. (2023). Contribution to European representatives of the genus Hygrocybe: Two new species and neotypification of Hygrocybe mucronella. Fungal Systematics and Evolution. - https://www.ingentaconnect.com/contentone/wfbi/fuse/pre-prints/content-f1_fuse_vol14_art18?crawler=true&mimetype=application/pdf
Kuo, M. (2014, November). Waxy caps: The Hygrophoraceae family, in part. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/hygrophoraceae.html
Created August 25, 2025 at 9:43 AM and last updated August 25, 2025 at 9:43 AM