Small-Spored Sunset Waxycap
Hygrocybe acutoconica var. microspora
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Hygrophorineae > Hygrocybaceae > Hygrocybe > Hygrocybe acutoconica
Description
The Small-Spored Sunset Waxycap (Hygrocybe acutoconica var. microspora) is a mushroom with an undetermined ecological role. It's uncertain if it is a decomposer, mycorrhizal, or some other type of mushroom. This mushroom can be found late sprint through fall under Oak and other deciduous trees. Hygrocybe acutoconica is widespread in North America but H. acutoconica var. microspora has only been found east of the Rocky Mountains and is differentiated by its more slimy cap surface and smaller spores. H. acutoconica was originally described from northeast Nebraska in the early 1900s.
The cap is conical to umbonate to flat, slimy to tacky, with colors ranging from yellow to orange to red. It does not bruise black some some other Hygrocybe sp.. The gills are free from the stem or narrowly attached to it, are yellowish or orangish, and have a slightly waxy texture. It does not have an annulus nor a volva. The spore print is white.
Observations
August 15th, 2023 Indian Cave State Park

#303
- Growing gregariously in open mixed oak/hickory woodland.
- Nearby Trees: Red Mulberry, Northern Red Oak, Ash, Eastern Red Bud, and Elm.
- Caps conical and cherry-red when young, then becoming flatter with a brilliant orange mottled with yellow tints, viscid. Young specimens with cortina-like veil.
- Lamellae bright yellow, waxy and free from stipe.
- Stipe yellow on younger specimens, later turning orange at maturity, with white basal mycelium.
- Flesh waxy
Additional Info
- Smell: not distinctive
- Taste: not distinctive
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAAGTGATTTGGGGATGTTGCTGGCCTCTCTCGGGAGGCAATGTGCACTCTCCAAAACAATTCACGATTTCCATCACACCCCTTGTGCACATCCTGTAGGGCAATGTCACCCCTCTCAAAGTAGAGGGGCTGTTGTCCTATGTATTCTCTCATCTAACACATTTCGAATGGTGCTCTTGGATGCATCTTGTGGATTATTTGTAACAAAGTAATCATATAAAACAACTTTCAACAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGAAACCATCAATGAGGACCTTTATTTTCGGACAGAGGCTTTCTCGTTGGAATATGGAGTGTGCTGGCTTGTTCAGCTCCTCTGAAATGCATTAGCGATGTGGTGTCCCACCTGCTTGAGCTTGCATTGGCATTGATAGTCATTCATGTCAGAGTAGTTCGGCTGTGGAAACGTTCACTTGCTCCTAATCGTGATGGACTCTGTTCCATCCTTTGACCCATATAACCTCAAATCAGGCAGGACTACCCGCTGAACTTView MycoMap DNA Results
References
Cantrell, S. A., & Lodge, D. J. (2000). Hygrophoraceae of the Greater Antilles: Hygrocybe subgenus Hygrocybe. Mycological Research, 104(7), 873-878. https://www.fpl.fs.usda.gov/documnts/pdf2000/cantr00a.pdf
Kuo, M. (2014, June). Hygrocybe acutoconica. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/hygrocybe_acutoconica.html
Kuo, M. (2014, November). Waxy caps: The Hygrophoraceae family, in part. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/hygrophoraceae.html
Created October 14, 2025 at 3:03 PM