Small-Spored Sunset Waxycap (Hygrocybe acutoconica var. microspora)
Small-Spored Sunset Waxycap (Hygrocybe acutoconica var. microspora)
Small-Spored Sunset Waxycap (Hygrocybe acutoconica var. microspora)
Small-Spored Sunset Waxycap (Hygrocybe acutoconica var. microspora)
Small-Spored Sunset Waxycap (Hygrocybe acutoconica var. microspora)
Small-Spored Sunset Waxycap (Hygrocybe acutoconica var. microspora)
Small-Spored Sunset Waxycap (Hygrocybe acutoconica var. microspora)
< Back to Home

Small-Spored Sunset Waxycap

Hygrocybe acutoconica var. microspora

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Hygrophorineae > Hygrocybaceae > Hygrocybe > Hygrocybe acutoconica


Description

The Small-Spored Sunset Waxycap (Hygrocybe acutoconica var. microspora) is a mushroom with an undetermined ecological role. It's uncertain if it is a decomposer, mycorrhizal, or some other type of mushroom. This mushroom can be found late sprint through fall under Oak and other deciduous trees. Hygrocybe acutoconica is widespread in North America but H. acutoconica var. microspora has only been found east of the Rocky Mountains and is differentiated by its more slimy cap surface and smaller spores. H. acutoconica was originally described from northeast Nebraska in the early 1900s.

The cap is conical to umbonate to flat, slimy to tacky, with colors ranging from yellow to orange to red. It does not bruise black some some other Hygrocybe sp.. The gills are free from the stem or narrowly attached to it, are yellowish or orangish, and have a slightly waxy texture. It does not have an annulus nor a volva. The spore print is white.


Observations

August 15th, 2023 Indian Cave State Park
 (Hygrocybe acutoconica microspora)

#303

  • Growing gregariously in open mixed oak/hickory woodland.
  • Nearby Trees: Red Mulberry, Northern Red Oak, Ash, Eastern Red Bud, and Elm.
  • Caps conical and cherry-red when young, then becoming flatter with a brilliant orange mottled with yellow tints, viscid. Young specimens with cortina-like veil.
  • Lamellae bright yellow, waxy and free from stipe.
  • Stipe yellow on younger specimens, later turning orange at maturity, with white basal mycelium.
  • Flesh waxy

Additional Info

  • Smell: not distinctive
  • Taste: not distinctive
DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAAGTGATTTGGGGATGTTGCTGGCCTCTCTCGGGAGGCAATGTGCACTCTCCAAAACAATTCACGATTTCCATCACACCCCTTGTGCACATCCTGTAGGGCAATGTCACCCCTCTCAAAGTAGAGGGGCTGTTGTCCTATGTATTCTCTCATCTAACACATTTCGAATGGTGCTCTTGGATGCATCTTGTGGATTATTTGTAACAAAGTAATCATATAAAACAACTTTCAACAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGAAACCATCAATGAGGACCTTTATTTTCGGACAGAGGCTTTCTCGTTGGAATATGGAGTGTGCTGGCTTGTTCAGCTCCTCTGAAATGCATTAGCGATGTGGTGTCCCACCTGCTTGAGCTTGCATTGGCATTGATAGTCATTCATGTCAGAGTAGTTCGGCTGTGGAAACGTTCACTTGCTCCTAATCGTGATGGACTCTGTTCCATCCTTTGACCCATATAACCTCAAATCAGGCAGGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject

References

Cantrell, S. A., & Lodge, D. J. (2000). Hygrophoraceae of the Greater Antilles: Hygrocybe subgenus Hygrocybe. Mycological Research, 104(7), 873-878. https://www.fpl.fs.usda.gov/documnts/pdf2000/cantr00a.pdf

Kuo, M. (2014, June). Hygrocybe acutoconica. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/hygrocybe_acutoconica.html

Kuo, M. (2014, November). Waxy caps: The Hygrophoraceae family, in part. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/hygrophoraceae.html


Created March 17, 2026 at 9:26 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.