Hortiboletus sp-IN03
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Boletales > Boletaceae > Hortiboletus
Description
Hortiboletus sp-IN03 is a provisional name given to a larger species that has been found in Indian Cave State Park.
The cap has an outer red surface that cracks to reveal a whitish-yellow context. The pores are irregular and angular. The hymenophore attachment is free from the stem.
August 16th, 2023 Field Notes - Indian Cave State Park:
Growing solo at the base of a honey locust in low riparian mixed hardwood area.
Nearby trees: Honey Locust, Elm, Kentucky Coffee Tree, Black Walnut, American Hickory, Northern Red Oak, Red Mulberry, American Sycamore.
- KOH: pileipellis yellow; hymenium: wine red; stipe: orangish
- Ammonia: pileipellis: yellowish orange; hymenium: darkening; stipe: brownish
- Bruising blue on margin between hymenium and pileipellis (presumed flesh bruising)
- Flesh: sulfur yellow, slowly turning faded blue.
- Cap: 9.5 cm wide; brick red; cracking with yellow undersurface
- Pores: dull yellow-olive; bruising blue; pores irregular; pore surface sunken at stipe intersection and decurrent.
- Stipe: 1cm wide; yellow at base becoming red at apex
DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAACATCGAGGGGGACTGTCGCTGGCTTCGGAGCGATCTGGAGCATGTGCACGTCTCTTTTCTTACACACACTCGTGCACAATTTGTAGGCCCTCGAGAGAGGGACTACGTTTTTCCACATCACATCCTTACGGGTATGTAACATGTATGGCGAGAAGGTATCTAGGCTGTCGCTCGACTCCGGTCGGGCCATGGTCGAACAAATATTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTCGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTCTCAACCATGTCTTGTGAAACGAGGCTTGGCTTGGACTTGGGGGTCGCTGGTGGCGAAGGCTGTCGGCTCTCCTGAAATGCATTAGCAAAGGGCAGCAAGTCCGTGACGTGGCACGGCCTTTTCGACGTGATAACGATCGTCGTGGGGCTGGAAGCGCCGGGCATGCATTGATTGTCTTGTTTGCTTCTAATTCATCCTTCGTCAATTGGACTCGGGACTCGACTGGGGGTTGGCTTAGCTATTAGTTGGTCGTGAGGCCGACGAACGCGGCCGGGCTCAGCTTCAGAGCGTTCGTGGTCTGGTTGTCGAAACTTTTTGACACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG
References
Vizzini, A. 2015. Nomenclatural novelties. Index Fungorum. 244:1-1 https://www.mycobank.org/details/19/10060139
Created August 25, 2025 at 9:43 AM and last updated August 25, 2025 at 9:43 AM