Hortiboletus sp-IN03 is a provisional name given to a larger species that has been found in Indian Cave State Park.

The cap has an outer red surface that cracks to reveal a whitish-yellow context. The pores are irregular and angular. The hymenophore attachment is free from the stem.

August 16th, 2023 Field Notes - Indian Cave State Park:

Growing solo at the base of a honey locust in low riparian mixed hardwood area.

Nearby trees: Honey Locust, Elm, Kentucky Coffee Tree, Black Walnut, American Hickory, Northern Red Oak, Red Mulberry, American Sycamore.

• KOH: pileipellis yellow; hymenium: wine red; stipe: orangish
• Ammonia: pileipellis: yellowish orange; hymenium: darkening; stipe: brownish
• Bruising blue on margin between hymenium and pileipellis (presumed flesh bruising)
• Flesh: sulfur yellow, slowly turning faded blue.
• Cap: 9.5 cm wide; brick red; cracking with yellow undersurface
• Pores: dull yellow-olive; bruising blue; pores irregular; pore surface sunken at stipe intersection and decurrent.
• Stipe: 1cm wide; yellow at base becoming red at apex

DNA Barcode ITS:

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAACATCGAGGGGGACTGTCGCTGGCTTCGGAGCGATCTGGAGCATGTGCACGTCTCTTTTCTTACACACACTCGTGCACAATTTGTAGGCCCTCGAGAGAGGGACTACGTTTTTCCACATCACATCCTTACGGGTATGTAACATGTATGGCGAGAAGGTATCTAGGCTGTCGCTCGACTCCGGTCGGGCCATGGTCGAACAAATATTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTCGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTCTCAACCATGTCTTGTGAAACGAGGCTTGGCTTGGACTTGGGGGTCGCTGGTGGCGAAGGCTGTCGGCTCTCCTGAAATGCATTAGCAAAGGGCAGCAAGTCCGTGACGTGGCACGGCCTTTTCGACGTGATAACGATCGTCGTGGGGCTGGAAGCGCCGGGCATGCATTGATTGTCTTGTTTGCTTCTAATTCATCCTTCGTCAATTGGACTCGGGACTCGACTGGGGGTTGGCTTAGCTATTAGTTGGTCGTGAGGCCGACGAACGCGGCCGGGCTCAGCTTCAGAGCGTTCGTGGTCTGGTTGTCGAAACTTTTTGACACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG