undefined (Hortiboletus sp-IN03)
undefined (Hortiboletus sp-IN03)
undefined (Hortiboletus sp-IN03)
undefined (Hortiboletus sp-IN03)
undefined (Hortiboletus sp-IN03)
undefined (Hortiboletus sp-IN03)
undefined (Hortiboletus sp-IN03)
undefined (Hortiboletus sp-IN03)
undefined (Hortiboletus sp-IN03)
undefined (Hortiboletus sp-IN03)
undefined (Hortiboletus sp-IN03)
undefined (Hortiboletus sp-IN03)
< Back to Home

Hortiboletus sp-IN03

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Boletales > Boletaceae > Hortiboletus


Description

Hortiboletus sp-IN03 is a provisional name given to a larger species that has been found in Indian Cave State Park.

The cap has an outer red surface that cracks to reveal a whitish-yellow context. The pores are irregular and angular. The hymenophore attachment is free from the stem.

August 16th, 2023 Field Notes - Indian Cave State Park:

Growing solo at the base of a honey locust in low riparian mixed hardwood area.

Nearby trees: Honey Locust, Elm, Kentucky Coffee Tree, Black Walnut, American Hickory, Northern Red Oak, Red Mulberry, American Sycamore.

  • KOH: pileipellis yellow; hymenium: wine red; stipe: orangish
  • Ammonia: pileipellis: yellowish orange; hymenium: darkening; stipe: brownish
  • Bruising blue on margin between hymenium and pileipellis (presumed flesh bruising)
  • Flesh: sulfur yellow, slowly turning faded blue.
  • Cap: 9.5 cm wide; brick red; cracking with yellow undersurface
  • Pores: dull yellow-olive; bruising blue; pores irregular; pore surface sunken at stipe intersection and decurrent.
  • Stipe: 1cm wide; yellow at base becoming red at apex

DNA Barcode ITS:

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAACATCGAGGGGGACTGTCGCTGGCTTCGGAGCGATCTGGAGCATGTGCACGTCTCTTTTCTTACACACACTCGTGCACAATTTGTAGGCCCTCGAGAGAGGGACTACGTTTTTCCACATCACATCCTTACGGGTATGTAACATGTATGGCGAGAAGGTATCTAGGCTGTCGCTCGACTCCGGTCGGGCCATGGTCGAACAAATATTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTCGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTCTCAACCATGTCTTGTGAAACGAGGCTTGGCTTGGACTTGGGGGTCGCTGGTGGCGAAGGCTGTCGGCTCTCCTGAAATGCATTAGCAAAGGGCAGCAAGTCCGTGACGTGGCACGGCCTTTTCGACGTGATAACGATCGTCGTGGGGCTGGAAGCGCCGGGCATGCATTGATTGTCTTGTTTGCTTCTAATTCATCCTTCGTCAATTGGACTCGGGACTCGACTGGGGGTTGGCTTAGCTATTAGTTGGTCGTGAGGCCGACGAACGCGGCCGGGCTCAGCTTCAGAGCGTTCGTGGTCTGGTTGTCGAAACTTTTTGACACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG

Observation


References

Vizzini, A. 2015. Nomenclatural novelties. Index Fungorum. 244:1-1 https://www.mycobank.org/details/19/10060139


Created February 26, 2026 at 8:43 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.