Tapioca Club
Holwaya mucida
Life > Fungi > Ascomycota > Pezizomycotina > Leotiomycetes > Leotiomycetidae > Thelebolales > Holwayaceae > Holwaya
Description
The Tapioca Club (Holwaya mucida) is a decomposer of wood and fruits in the fall. At Indian Cave State Park, it has found in great numbers (hundreds to thousands) between the bark fissures of fallen American Linden trunks (Tilia americana). It features a black club form with a cream-colored, tapioca pudding-like apex which is easily rubbed off when fresh. The apex later turns gray-colored and crusty with age. The species shape is polymorphic and can also be found in a black cup form amidst the clubs (not pictured).
Observations
August 17th, 2023 Indian Cave State Park

#347
- Growing in troops (hundreds to thousands) on large fallen American Linden elevated just above creek on Northwest-facing slope in low, shady woodland draw.
- Hymenium elipsoid, purplish with white powder.
- Stipe black and tough.
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAGAACATGCCCTTCGGGGTAGATCTCCCACCCTTTGTATATTATACCTTTGTTGCCTTGGCAGGCCCGTCTCCGGACCGCTGGCTTCGGCTGGCCCGCGCCTGTCAGAGGACCCCAAACTCTATTGTTAATATCGTCTGAGTACTATTTTAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAAGCTCAGCTTGGTATTGGGCCTCGCCGTCCCGGCGGGCCTTAAAATCAGTGGCGGTGCCGTCTGGCTCCAAGCGTAGTAATTCTTCTCGCTTCTGGAGGCCGACGTGTGCTCGCCAGCAACCCCAATTTTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTT
October 25th, 2023 Indian Cave State Park

484
Nickname: Tapioca Club
Sequence Number: #0484
Observed At: Thursday, October 26, 2023 10:44 AM
Location: 40.260510557631, -95.56686401378279
Form Group: [1]
[1] Trooping inside of bark grooves on large fallen Linden in low, open, moist mixed oak/hickory draw.
Asco/club; White surface rubbing off reminiscent, of tapioca; Taste: indistinguishable, texture like tapioca; Growing on large brown rot Linden tree;
Created June 26, 2025 at 10:30 AM and last updated June 26, 2025 at 10:30 AM