Shadowy Oysterling (Hohenbuehelia grisea)
Shadowy Oysterling (Hohenbuehelia grisea)
Shadowy Oysterling (Hohenbuehelia grisea)
Shadowy Oysterling (Hohenbuehelia grisea)
Shadowy Oysterling (Hohenbuehelia grisea)
Shadowy Oysterling (Hohenbuehelia grisea)
Shadowy Oysterling (Hohenbuehelia grisea)
Shadowy Oysterling (Hohenbuehelia grisea)
Shadowy Oysterling (Hohenbuehelia grisea)
< Back to Home

Shadowy Oysterling

Hohenbuehelia grisea

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Pleurotineae > Pleurotaceae > Hohenbuehelia


Description

Hohenbuehelia grisea, known as the Shadowy Oysterling, appears in fall in woodland settings. It usually grows directly on decaying hardwood debris, though also has been found on debris including Black Walnut (Juglans nigra) shells. The species name grisea refers to its typical gray coloration.

The cap is thin, gray, and bald, with an inrolled margin when fresh. The tissues are semi-translucent and delicate. Gills are pale gray to cream, wavy, and interspersed with many short gills. It is sessile (directly attached the substrate without a stem) or features a short pseudosteme. The spore print is white.


Observations

August 8th, 2023 Indian Cave State Park
Shadowy Oysterling (Hohenbuehelia grisea)

284

Growing on Black Walnut she’ll in low, moist, shady woodland draw.

  • cap surface: bald, tissues thin and transparent will inrolled margin.
  • Gills wavy with frequent partial gills.
  • Cap attached by pseudostem.
DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATTCAACTCGCGAAGTTGTTGCTGGCTCCTCTGGGGCATGTGCACACTTCGCAAGTCATTTCAACCACCTGTGAACCTTTTGTAGTCTTGGGAGACGCTATTATCAAAGGAAACTTTGGATTTGAATGCTGCGGGCTTGCAAAAGTCGGCTTCGTTCTACAGCAGAACCCGGGTCTATGCTTTATATACCCCAATTGTATGTCAATGAATGTGATGCAAGGGCTTTCCAGCCTTTAAATCAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTGGAAGGCTTTTGAAGTCGTCTTAAGGCTTGGATCTGGAGGTTGCGGGCTTCATTGCGAAGTCGGCTCCTCTTAAATGTATTAGCTGGGTTTGCGCCTTCAGCCTATTGGTGTGATAATTATCTACGCCTCTGGGTCGTTAGCGTGTTATACTTCTCTAGCTTCTAACCGTCCCTTGTGGACAACTCTTGACCATTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject

References

Stevens, F. A. (n.d.). *Hohenbuehelia grisea*. In *California Fungi*. MykoWeb. Retrieved April 19, 2025, from https://www.mykoweb.com/CAF/species/Hohenbuehelia_grisea.html


Created March 17, 2026 at 9:26 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.