Shadowy Oysterling
Hohenbuehelia grisea
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Pleurotineae > Pleurotaceae > Hohenbuehelia
Description
Hohenbuehelia grisea, known as the Shadowy Oysterling, appears in fall in woodland settings. It usually grows directly on decaying hardwood debris, though also has been found on debris including Black Walnut (Juglans nigra) shells. The species name grisea refers to its typical gray coloration.
The cap is thin, gray, and bald, with an inrolled margin when fresh. The tissues are semi-translucent and delicate. Gills are pale gray to cream, wavy, and interspersed with many short gills. It is sessile (directly attached the substrate without a stem) or features a short pseudosteme. The spore print is white.
Observations
August 8th, 2023 Indian Cave State Park

284
Growing on Black Walnut she’ll in low, moist, shady woodland draw.
- cap surface: bald, tissues thin and transparent will inrolled margin.
- Gills wavy with frequent partial gills.
- Cap attached by pseudostem.
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATTCAACTCGCGAAGTTGTTGCTGGCTCCTCTGGGGCATGTGCACACTTCGCAAGTCATTTCAACCACCTGTGAACCTTTTGTAGTCTTGGGAGACGCTATTATCAAAGGAAACTTTGGATTTGAATGCTGCGGGCTTGCAAAAGTCGGCTTCGTTCTACAGCAGAACCCGGGTCTATGCTTTATATACCCCAATTGTATGTCAATGAATGTGATGCAAGGGCTTTCCAGCCTTTAAATCAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTGGAAGGCTTTTGAAGTCGTCTTAAGGCTTGGATCTGGAGGTTGCGGGCTTCATTGCGAAGTCGGCTCCTCTTAAATGTATTAGCTGGGTTTGCGCCTTCAGCCTATTGGTGTGATAATTATCTACGCCTCTGGGTCGTTAGCGTGTTATACTTCTCTAGCTTCTAACCGTCCCTTGTGGACAACTCTTGACCATTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTView MycoMap DNA Results
References
Stevens, F. A. (n.d.). *Hohenbuehelia grisea*. In *California Fungi*. MykoWeb. Retrieved April 19, 2025, from https://www.mykoweb.com/CAF/species/Hohenbuehelia_grisea.html
Created September 25, 2025 at 4:19 PM and last updated September 25, 2025 at 4:19 PM