undefined (Helvellosebacina concrescens-IN02)
undefined (Helvellosebacina concrescens-IN02)
undefined (Helvellosebacina concrescens-IN02)
undefined (Helvellosebacina concrescens-IN02)
undefined (Helvellosebacina concrescens-IN02)
< Back to Home

Helvellosebacina concrescens-IN02

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Sebacinales > Sebacinaceae > Helvellosebacina


Description

Helvellosebacina concrescens is a mycorrhizal fungus that fruits from soil in woodlands in the summer, often attached to the bases of herbaceous stems, usually grasses. It grows singularly to gregariously in shaded areas in forests with broadleaf trees. The genus name combines Helvella (referring to the vaguely saddle- or cup-shaped growth forms) and Sebacina (the typical genus for this form and niche), and includes species with variable forms ranging from crust-like to upright lobed structures (Oberwinkler et al., 2014).

Fruiting bodies are semi-transparent and cloudy in appearance, often forming upright, lobed, or irregular masses. They arise directly from soil and sometimes appear fused at the base. The texture is soft and gelatinous when fresh. Odor is sweet, bubblegum-like; taste is not distinctive. The spore print is white.


Observations

July 26th, 2023 Indian Cave State Park
 (Helvellosebacina concrescens)

#262

  • Growing gregariously from soil, attached to nearby herbaceous plant stems in mixed oak/hickory woodland.
  • Nearby Trees: American Hophornbeam, Shagbark Hickory, Chinkapin Oak, Elm, and Northern Red Oak.
  • Fruiting bodies semi-transparent (cloudy).

Additional Info

  • Smell: reminiscent of bubblegum
  • Taste: not distinctive
DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGATGTTAACTTGTCTGCCTTCAGTGCTGGCTCCTTGAAGAGCATGTGCACGTTGGTGGGCATTTATATCGAACCCCCATTTGTGCACCTTGCCTCTGCTGGCTTCGGCTGGCAGAGGATTTTTTTACACCCATACGAATGTAATAGATAATAATGTTGTGCTGAGCACTACAAATGTACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCAAAGGGTATGCTCGTTTGAGTGTCATTATACTCTCACACTCTCTAATTATTAGAGAGCGGTGGAATTGGGTGTTGCCTGGTGCTTGCTGTCAGGCTCATCTCAAATGCGTTAGTGCGACTGCTAGTTGGACATAGTACGGCGTGATAAGTAAACCCTCGCTGTTTTAGGTCTAACTAGTTGCTCTGTGCTTCAAACGGTCTTCGGACAATCTCTGATAATTTGACCTCAAATCGAGTAGGACCACCCGCTGAACTTAAG
View MycoMap DNA Results
Observation by thefungiproject

References

Oberwinkler, F., Riess, K., Bauer, R. et al. Morphology and molecules: the Sebacinales, a case study. Mycol Progress 13, 445–470 (2014). https://doi.org/10.1007/s11557-014-0983-1


Created August 10, 2026 at 10:51 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.