Tender Nesting Polypore (Hapalopilus rutilans)
Tender Nesting Polypore (Hapalopilus rutilans)
Tender Nesting Polypore (Hapalopilus rutilans)
Tender Nesting Polypore (Hapalopilus rutilans)
Tender Nesting Polypore (Hapalopilus rutilans)
Tender Nesting Polypore (Hapalopilus rutilans)
< Back to Home

Tender Nesting Polypore

Hapalopilus rutilans

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Polyporales > Phanerochaetaceae > Hapalopilus


Description

The Tender Nesting Polypore (Hapalopilus rutilans) is a decomposer of wood which is common on fallen Hickory (Carya sp.). It can be found from the spring through the fall. The cap is colored orangish to brownish and does not have a stem (sessile). There are angular pores underneath the cap. A distinctive feature of this mushroom is the vivid purple color that is displayed when a drop of KOH or Ammonia is applied on the surface (both are strong chemical bases that change the pigmentation).

Also known as Hapalopilus nidulans.

Ethnomycology

Due to this mushroom's vibrant colors in combination with chemicals, it is a common source of pigment for dying natural fibers (yarn, thread, etc.) making it a valuable mushroom for mycocrafting. (Bloom & Dye, 2024)


Observations

June 14th, 2023 Indian Cave State Park
Tender Nesting Polypore (Hapalopilus rutilans)

#110

Growing gregariously on upper portion of fallen Shagbark Hickory in low, open mixed oak/hickory woodland near river.

KOH violet on tap and ammonia a more vibrant shade of light purple.

DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATTGAAACAGGCTGTAAGCTGATCTCTATCTGAGATATGTGCACGCCTGGCCATCATTCAAACCTCTGTGCACCTATTGTAGGGATGGTGAAAGTCTTTGATTAGTCTGAAACCTCTCTATGTTTTTACTACAAACGCTTCAGTTATAGAATGTCAATCTTTGGGTATAATGGAAATATATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTATCATGGAATTCTCAACCTTTAATACTTTATTGTATTGAAGGCTTGGAGTTGGAGGTTTTGTGCTGGCCTTTAATAGGTTGGCTCCTCTGAAATACATTAGCGTCAGTGCTCTATGGATCGCTTCGGTGTGATAATTATCTGCGCCGTAGTTGTGAAGTAATGAATACGCTTCTAATCGTCCTGTAATTGGACAATAACTATGATTTTTGATCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG
View MycoMap DNA Results
Observation by thefungiproject

References

Bloom & Dye. (2024). Hapalopilus nidulans: Mushroom Color Atlas. Hapalopilus Nidulans: Mushroom Color Atlas. https://mushroomcoloratlas.com/mushroom/hapalopilus_nidulans/

Kuo, M. (2018, December). Hapalopilus nidulans. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/hapalopilus_nidulans.html


Created March 17, 2026 at 9:26 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.