Chestnut Bolete (Gyroporus castaneus-IN07)
Chestnut Bolete (Gyroporus castaneus-IN07)
Chestnut Bolete (Gyroporus castaneus-IN07)
Chestnut Bolete (Gyroporus castaneus-IN07)
Chestnut Bolete (Gyroporus castaneus-IN07)
Chestnut Bolete (Gyroporus castaneus-IN07)
Chestnut Bolete (Gyroporus castaneus-IN07)
Chestnut Bolete (Gyroporus castaneus-IN07)
< Back to Home

Chestnut Bolete

Gyroporus castaneus-IN07

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Boletales > Gyroporaceae > Gyroporus


Description

The Chestnut Bolete (Gyroporus castaneus) is a mycorrhizal (and reportably saprobic) bolete that can be found in woodland soil and disturbed areas. Although boletes generally associate with a mycorrhizal host tree, this mushrooms has reportably been found in areas without a visible mycorrhizal symbiont. Otherwise, it has been associated with Oaks, other broadleaf trees, and conifers. It can be found growing alone or in small groups in July, August, and September in eastern North America.

2024 DNA results identified the survey specimen as Gyroporus "castaneus-IN07" suggesting it to be a genetically divergent species to Gyroporus castaneus in the strict sense. This cryptic name is a placeholder until it can be published formally.

The cap shape is evenly rounded, becoming flat with age. The flesh consistency is hard and brittle. It often splits at the margin at maturity. The cap texture is smooth to slightly velvety. The cap color features chestnut brown, yellowish brown, cinnamon brown to brownish orange.

Cap

chestnut
#79443B
chestnut-brown
#79443B
chestnut-brown
#674C47
chestnut
#635147
golden chestnut
#6F4E37
Strong Yellowish Brown
#996515
Deep Yellowish Brown
#654522
Light Yellowish Brown
#C19A6B
Brownish Orange
#AE6938
cinnamon
#A67B5B
cinnamon
#BE8A3D
cinnamon-brown
#6F4E37
cinnamon
#C19A6B
cinnamon brown
#826644

The pore shape is circular to slightly angular. It is colored white to cream and doesn't bruise when handled:

Pores

White
#F2F3F4
milk white
#F0EAD6
cream
#F3E5AB
cream color
#F8DE7E

The stem is brittle and becomes cottony hollow with age. It is colored similarly to the cap (concolorous), though sometimes paler.

Stem

Generally regarded as edible (Pavelle, 2025).


Observations

July 26th, 2023 Indian Cave State Park
Chestnut Bolete (Gyroporus castaneus)

#245

G smithii or G borealis

  • Growing gregariously near disturbed horse trail in open mixed oak/hickory woodland edge.
  • Nearby Trees: Black Oak, Black Cherry, Chinkapin Oak, Elm, and Ash.
  • Caps light brown, subtomentose and firm.
  • Hymenium consisting of cream white circular pores that are unchanging when damaged.
  • Stipe light brown similar to cap, with central pith and slightly exuding liquid where snapped.
  • Flesh unchanging when bruised or cut.
  • Smell: not distinctive.
  • Taste: not distinctive.
DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAGGGATAAAACGAAGGACCGTACGACCGAGTCGGTCTCGGTCATGTACGGTCCGGGTCGGTCTTTCCTGTGCACGCGTCGTAGGTCTTCGGGCCTACGTTCATACACCTCTCGGTGTTCGAACGTCCATGGACTGTGACCGCCCGACCGTCGTGTCGGGCGAGAACGCATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGGACGCAGCGAATCGCGATAAGTAATGTGAATTGCAGATCTTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTCGGTATTCCGAGGAGCATGCCTGTCTGAGTGTCTGGACTATACTCTCGGTTGCGAGATCCTTTCGGGGTATCGAAACCGGAATTTGGGAGCTTGCGGGCGTCCTCGGTCGAGGTGACGTCGGCTCTCCTGAAATGCATTAGCGGAGAGGAACGGCACCGAAGCCAAGCGATCGGAGCGCGACCTTTTCCCTCGGCGTCGTAAGGATCGCCGTGGGCTCGGGAAGCGTGAGCGAGGTTTTTCGGGGCATGACGTGTCTCACGCTGCTAGCACGGTCGGCGAGCCTCGGGCGTCGTCGGACACGTTTTCAGCACTCGGCCTCAGATCAGGCAGGGCTACCCGCTGAACTTAAG

References

Halling, R. E. (2024). Taxon Details: Gyroporus castaneus (Bull.:Fr.) Quél. The New York Botanical Garden. https://sweetgum.nybg.org/science/projects/boletineae/taxon-details/?irn=254298

Kuo, M. (2013, December). Gyroporus castaneus. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/gyroporus_castaneus.html

Pavelle, S. (2015b, July 24). Gyroporus f/k/a castaneus (“Chestnut Bolete”). The Bolete Filter. https://boletes.wpamushroomclub.org/product/gyroporus-castaneus/

Quélet, Lucien. (1886). Enchiridion fungorum in Europa media et praesertim in Gallia vigentium (p. 161). O. Doin. https://www.biodiversitylibrary.org/page/32653197

Zeller, D. (2025, January). Nature Colors. Retrieved from beta site: https://naturecolors.netlify.app/

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Field Guide Download | About | Contact | © Fungi Project 2025