Ganoderma lobatum
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Polyporales > Ganodermataceae > Ganoderma
Description
Ganoderma lobatum is a sessile polypore found on buried roots, stumps, or compacted soil, often near woodland edges or along trails, appearing from late spring through fall. Fruiting bodies may collect debris as they develop, becoming partially embedded with soil and leaf litter.
The cap displays concentric zones of black, dark brown, and lighter brown, with a white growing edge. The surface is typically dull or slightly velvety. The pore surface is white and lumpy, bruising gray where damaged. The strong, sweet odor and bitter taste are notable. Chemical reactions include yellow staining on the hymenium with both KOH and ammonia.
Observations
August 9th, 2023 Indian Cave State Park

289
Growing alone from a small firmly attached stump or root ball on well compared soil on trail near the edge of a high, open, shady oak/hickory woodland.
- Cap: concentric zones of black, dark brown, and light brown with outer new growth white. Sessile.
- Hymenium: white and lumpy. Full of trail debris/duff fused in tissue. Bruising gray.
- KOH: yellow on hymenium.
- Ammonia: light yellow on hymenium.
- Smell: strong, sweet
- Taste: strong, bitter.
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAGTTTTGACTGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCGCTCTACACCTGTGCACTTACTGTGGGTTACAGGATCGCGAAACGGGCTCTTTACGGGGCTCGCGGAGCGCGCTTGTGCCCGCGTTTATCACAAACCCCATGAAGTATTAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACTTACGAGCTTCTTGCGAGGTTTGTAGGCTTGGACTTGGAGGCTTGTCGGTCTTTACAGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGGTTGTCGGTGTGATAATGTCTACGCCGCGACCGTGAAGCATTTGGCAAGCTTCTAACCGTCTCGGTATAGAGACAAGTTTATGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGView MycoMap DNA Results
References
Ganoderma lobatum (Schw.) Atk. Fig. 141 https://www.mycobank.org/details/26/48360
Ganoderma lobatum (Schw.) Lowe https://www.mycobank.org/details/26/689
Kuo, M. (2019, November). Ganoderma lobatum. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/ganoderma_lobatum.html
Created June 26, 2025 at 10:30 AM and last updated June 26, 2025 at 10:30 AM