undefined (Ganoderma lobatum)
undefined (Ganoderma lobatum)
undefined (Ganoderma lobatum)
undefined (Ganoderma lobatum)
undefined (Ganoderma lobatum)
undefined (Ganoderma lobatum)
undefined (Ganoderma lobatum)
undefined (Ganoderma lobatum)
< Back to Home

Ganoderma lobatum

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Polyporales > Ganodermataceae > Ganoderma


Description

Ganoderma lobatum is a sessile polypore found on buried roots, stumps, or compacted soil, often near woodland edges or along trails, appearing from late spring through fall. Fruiting bodies may collect debris as they develop, becoming partially embedded with soil and leaf litter.

The cap displays concentric zones of black, dark brown, and lighter brown, with a white growing edge. The surface is typically dull or slightly velvety. The pore surface is white and lumpy, bruising gray where damaged. The strong, sweet odor and bitter taste are notable. Chemical reactions include yellow staining on the hymenium with both KOH and ammonia.


Observations

August 9th, 2023 Indian Cave State Park
 (Ganoderma lobatum)

289

Growing alone from a small firmly attached stump or root ball on well compared soil on trail near the edge of a high, open, shady oak/hickory woodland.

  • Cap: concentric zones of black, dark brown, and light brown with outer new growth white. Sessile.
  • Hymenium: white and lumpy. Full of trail debris/duff fused in tissue. Bruising gray.
  • KOH: yellow on hymenium.
  • Ammonia: light yellow on hymenium.
  • Smell: strong, sweet
  • Taste: strong, bitter.
DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAGTTTTGACTGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCGCTCTACACCTGTGCACTTACTGTGGGTTACAGGATCGCGAAACGGGCTCTTTACGGGGCTCGCGGAGCGCGCTTGTGCCCGCGTTTATCACAAACCCCATGAAGTATTAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACTTACGAGCTTCTTGCGAGGTTTGTAGGCTTGGACTTGGAGGCTTGTCGGTCTTTACAGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGGTTGTCGGTGTGATAATGTCTACGCCGCGACCGTGAAGCATTTGGCAAGCTTCTAACCGTCTCGGTATAGAGACAAGTTTATGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG
View MycoMap DNA Results
Observation by thefungiproject

References

Ganoderma lobatum (Schw.) Atk. Fig. 141 https://www.mycobank.org/details/26/48360

Ganoderma lobatum (Schw.) Lowe https://www.mycobank.org/details/26/689

Kuo, M. (2019, November). Ganoderma lobatum. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/ganoderma_lobatum.html


Created February 26, 2026 at 8:43 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.