Funeral Bell
Galerina marginata
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Agaricineae > Hymenogastraceae > Galerina
Description
Galerina marginata is a decomposer of wood that can be found in the spring, summer, and fall. It is a common mushroom to stumble upon on forays. It either grows solidarity, clustered, or in small groups (gregarious). It is a gilled mushroom that produces a rusty brown spore print. Other 'tells' are the presence of an annulus, hygrophanous color changes (especially on the cap), and a fibrous stem that features a color transition from light to dark colors from the apex to the base. Also, when fresh the stipe readily bruises darker when handled.
Toxicology
This mushroom is known to be fatally toxic via the presence of Amatoxins. These toxins can also be found in some species the genera Amanita and Lepiota. 50% of Amatoxin poisonings are fatal. The toxin prevents the body from producing cells by inhibiting the enzyme that creates RNA. This effect is a major issue for organs like the liver and kidneys that regenerate cells regularly resulting in fatalities associated with those crucial organ failures.
The effects of the toxin appear in stages. The first stages don't present discomfort in the victim, though the toxin is already damaging the liver and kidneys. Next, are severe abdominal cramps, vomiting, and bloody diarrhea. Paradoxically, the victim seems to recover from this and seems much better. This is an illusion, as it signifies the later stages in which the results can be fatal due to kidney and liver failure. Read more about Amatoxins here.
It's important to not wait for symptoms to appear if you suspect that someone has ingested Amatoxins. Rushing to the hospital to remove the toxins before they can be absorbed by the body and massively increase the victim's chance of survival. Call 9-1-1 and get the individual medical attention IMMEDIATELY. Afterwards, please report poisonings to the North American Mycological Association to contribute to our understanding of wild mushroom safety and help others.
Synonyms
- Galerina autumnalis
- Galerina oregonensis
- Galerina unicolor
- Galerina venenata
Observations
May 17th, 2023 Indian Cave State Park

48
Growing on well-rotted hardwood log on East-facing slope above spring-fed creek in riparian woodland area.
TGTTGCTGAGAAGCTGATCAAACTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATGAACTTGGCGTGGTTGTCGCTGGCCCTCTCGGGGGTATGTGCACGCCCGTCATCTTTATCTTTCCACCTGTGCACACTTTGTAGACTTGAATAGTATTTTCTGAGGCAACTCAGTCGGGAGGATTGCTGGTATTTATCAGCTCTCCTTGCATTATTCAAGCCTATGTTTTTCATATACCCCAAAAATGTAACAGAATGTATCATTGGGCCTTGTGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTATCAATTTTCACAAGTTGGTAATGGCTTGGACTTGGGGGCTTTTTGCTGGCTTCGTCAAGAGGTCTGCTCCCCTTAAATGTATTAGCCGGTCCCCTTGTGGAGTCGTCTATTGGTGTGATAATTATCTACGCCGTGGGCCTTCACTTTAAATGGGTTGTACTGCTTCTAATCGTCTGTTAAGTCAGACAAATAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGA
October 23rd, 2023 Indian Cave State Park

473
Observed At: Tuesday, October 24, 2023 12:37 PM Created At: Tuesday, October 24, 2023 12:37 PM Last Modified At: Tuesday, October 24, 2023 12:43 PM Location: 40.26423381054019 -95.55869768414973 Form Group: Form Group: agaric Substrate: Substrate: lignicolous Growth Habit: Growth Habit: gregarious Habitat: Low shaded, moist paw paw draw in oak/hickory woodland. Growing on Tree: Tree: ( Desciduous ) Cap: Pileus: ( Shape: ( Top view: orbicular; Profile: convex ); Surface: ( texture: smooth; moisture: dry-silky to dry-dull; color: yellowish brown to cinnamon-buff to buff ); Margin: ( Features: striate ) ) Shape: Shape: ( Top view: orbicular; Profile: convex ) Surface: Surface: ( texture: smooth; moisture: dry-silky to dry-dull; color: yellowish brown to cinnamon-buff to buff ) Margin: Margin: ( Features: striate ) Gills: Lamellae: ( Attachment: decurrent to adnate; Spacing: subdistant; Edges: even; Misc Features: unequal ) Stem: Stipe: ( shape: terete to equal; surface: fibrous; flexibility: fibrous to rigid ) Annulus: Annulus: ( Shape: subperonate; Texture: fibrillose; Fate: ring )
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATGAACTTGGCGTGGTTGTCGCTGGCCCTCTCGAGGGTATGTGCACGCCCGTCATCTTTATCTTTCCACCTGTGCACACTTTGTAGACTTGAATAGTATTTTCTGAGGCAACTCAGTCGGGAGGATTGCTGGTATTTATCAGCTCTCCTTGGATTATTCAAGCCTATGTTTTTCATATACCCCAAAAATGTAACAGAATGTATCATTGGGCCTTGTGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTATCAATTTTCACAAGTTGATAATGGCTTGGACTTGGGGGCTTTTTGCTGGCTTCGTCAAGAGGTCTGCTCCCCTTAAATGTATTAGCCGGTCCCCTTGTGGAGTCGTCTATTGGTGTGATAATTATCTACGCCGTGGGCCTTCACTTTAAATGGGTTGTACTGCTTCTAACCGTCTGTTAAGTCAGACAAATAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTView MycoMap DNA Results
May 13th, 2024 Fontenelle Forest

579
- Growing on fallen hardwood log in mixed Oak woodland.
- Stipe with annular zone present.
June 3rd, 2025 Schramm Park

Not Collected.
Growing on treated wooden pole.
April 28th, 2024 Indian Cave State Park

519
- Growing on large well-rotted Eastern Cottonwood log in low, moist riparian woodland area near small creek.
- Spore Print: brown
May 13th, 2024 Fontenelle Forest

564
- Growing on fallen Northern Red Oak branch in mixed oak woodland.
- Taste: not distinctive
- Smell: fungoid
References
Beug, M. (2024, April 23). Mushroom Poisoning Syndromes - North American Mycological Association. North American Mycological Association. https://namyco.org/interests/toxicology/mushroom-poisoning-syndromes/#amatoxin
Kuo, M. (2016, July). Galerina marginata. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/galerina_marginata.html
Created August 21, 2026 at 12:03 PM














































