Green Cheese Polypore (Fomitopsis spraguei)
Green Cheese Polypore (Fomitopsis spraguei)
Green Cheese Polypore (Fomitopsis spraguei)
Green Cheese Polypore (Fomitopsis spraguei)
Green Cheese Polypore (Fomitopsis spraguei)
Green Cheese Polypore (Fomitopsis spraguei)
Green Cheese Polypore (Fomitopsis spraguei)
Green Cheese Polypore (Fomitopsis spraguei)
Green Cheese Polypore (Fomitopsis spraguei)
< Back to Home

Green Cheese Polypore

Fomitopsis spraguei

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Polyporales > Fomitopsidaceae > Fomitopsis


Description

The Green Cheese Polypore (Fomitopsis spraguei) is a decomposer and parasite of wood and can be found from spring through fall. It is commonly found on the base of broadleaf tree trunks growing in groups or alone. It bruises green when handled. Furthermore, it commonly exudes droplets of "mycosweat" or guttation which is a liquid secreted by the fungus that include digestive enzymes and antimicrobial compounds.


Observations

June 25th, 2023 Indian Cave State Park
Green Cheese Polypore (Fomitopsis spraguei)

123

Growing on the interior of large burned out Northern Red Oak on mixed oak/hickory ridgetop in woodland.

  • In close proximity to Trichaptum biforme and Fuscoporia gilva.

  • Upper cap, and hymenium slowly bruising olive green.

  • Hymenophore with copious amount of guttation, even for how dry weather conditions have been recently.

DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATTTTGAAAGGGGGTTGTAGCTGGCCTTTCCGTCTGGGAGGCATTTTGTGCACACCCCGATCATCGTCCATTCACACCTGTGCACACTCTGTAGGTTGGTGGTACGAGGCACGGTCTTCATTGATTGTGCTTTGGAAGCCGTCCTATGTCTTATTTACAAACTCTTGTTGGTTTAAAGAATGTCTGTTTGCGTTCAACGCGTCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTTCATTTGCTTTTGTGAATGGAGATTGGATTTGGAGGTTTTATTGCTGGACTTTGATTTAGTTCAGCTCCTCTTGAATGCATCAGCTTGAGTCTTTTTGTGGATCGGCTTCGGTGTGATAATTGTCTGCGCCGTTCTGTGAAGCGATGTACTTGGCTTCTAATTGTCCTTTGGACCCTTGACCTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAG
View MycoMap DNA Results
Observation by thefungiproject
June 26th, 2024 Indian Cave State Park
Green Cheese Polypore (Fomitopsis spraguei)

Not Collected

  • Growing on the base of Black Cherry tree.

Observation by thefungiproject

References

Kuo, M. (2016, August). Fomitopsis spraguei. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/fomitopsis_spraguei.html


Created February 26, 2026 at 8:43 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.