Fomitopsis meliae
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Polyporales > Fomitopsidaceae > Fomitopsis
Description
Fomitopsis meliae appears from spring through fall on fallen hardwood, especially Ash (Fraxinus spp.), where it grows scattered along barkless portions of downed trunks. These observations were made near the edge of an open Oak–Hickory woodland. The species name meliae refers to ash trees, drawing from an old Latin name for the genus Fraxinus.
Caps are firm and damp, dingy white, and bruise dark gray when scratched. The pore surface is similarly colored, with tiny round pores that bruise gray and may elongate as the fruit body thickens. The flesh has a tough, leathery consistency when fresh, drying to a tough, corky texture. Odor is fragrant or fruity, and the taste is slightly bitter.
Observations
August 1st, 2023 Indian Cave State Park

#270
- Growing scattered on baqrkless portions of fallen Ash tree in open mixed oak/hickory woodland near edge.
- Caps growing partially resupinately, firm damp, dingy white, bruising dark gray where scratched.
- Hymenium similar color to cap, with tiny round pores, bruising gray where damaged. Some pores elongating as sporocarp thickens.
- Flesh tough and leathery.
- Smell: fragrant/fruity
- Taste: slightly bitter
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATTCTGAAAGGGGTTGTTGCTGGCCGTCAGCGGCATGTGCACGCCCTGATCATTATCCATCTCACACACCTGTGCACACACTGTAGGTCGGTTTGTGGCTGGAGGTGGGCACTCTGTGTCTGCTTTGGTTGTAGGCCTTCCTATGTTTTATTACAAACTACTTCAGTTTAAAGAATGTCACTCTTGCGTCTAACGCATTTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCTATTTGCTTTTGTGAATAGAGCTTGGACTTGGAGGTTTATTGCCGGTACACCTGTGATCGGCTCCTCTTGAATGCATTAGCTCGAACCTGTGTGGATCAGCTATCGGTGTGATAATTGTCTACGCCGTTGCTGTGAAGCATGTTAATGGGGGTCGGCTTCTAATCGTCCTTTTACTTGGGGACAATGACTTTGACCTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGView MycoMap DNA Results
References
Fomitopsis meliae (Underw.) Gilbn. & Ryv., comb. nov. Fig. 129 https://www.mycobank.org/details/26/47773
Created August 25, 2025 at 9:43 AM and last updated August 25, 2025 at 9:43 AM