undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
undefined (Elaphomyces sp.)
< Back to Home

Elaphomyces sp.

Life > Fungi > Ascomycota > Pezizomycotina > Eurotiomycetes > Eurotiomycetidae > Elaphomycetales > Elaphomycetaceae > Elaphomyces


Observations

August 31st, 2023 Indian Cave State Park
 (Elaphomyces)

#355

  • Hypogeous in open mixed oak/hickory woodland ridge.
  • Nearby Trees: Shagbark Hickory, Chinkapin Oak, Ash, American Hophornbeam, Black Oak, and Black Walnut.
  • Exoperidium thin and tan.
  • Interior powdery and black with whitish inner fibrous material.
  • Smell: foul
  • Microscopy: mounted in Melzer's. Spores ornamented in dense layer of curled spines. (Reminiscent of Scleroderma)

Observation by thefungiproject
August 31st, 2023 Indian Cave State Park
 (Elaphomyces)

#354

  • Hypogeous in mixed oak/hickory woodland ridge.
  • Nearby Trees: Shagbark Hickory, Chinkapin Oak, Ash, American Hophornbeam, Black Oak, and Black Walnut.
  • Peridium gray and fairly thick.
  • Interior laden with powdery light colored spores.
  • Smell: slightly foul.
  • Taste: not distinctive
  • Microscopy: mounted in Melzer's.
DNA Barcode ITS:
GAACGCACATTGCGCCCTTTGGTATTCCAGAGGGCATGCCTGTCCGAGTGTCATCGCCTCCCTTCCAAGCTCAGCTTGGGTGTTGGGCTGTCATCCCTGGCCCCCTTAGGGGTTTGGGATGGGCCTGAAAGGCAGCGGCGGTGTGGTGCTTAGCCTTTGAGTGGATGGGCTGTTTCCCCGCTCCCATAGGCTTGGCTACCTTGGCACCGGCTTTCCCCCCTTCTTTGGAGTCGTTCTTGTTGACTCCATCCAGTAGGCCTCGGATCAGGTAAGGATACCCGCTGAACTTAA
View MycoMap DNA Results
Observation by thefungiproject
February 27th, 2025 Indian Cave State Park
 (Elaphomyces)

AA89

Hypogeous, roughly 3-4 cm deep in the side wall of a rodent dig site, in upland mixed oak/hickory woodland.

  • Nearby Trees: Black Oak, Chinkapin Oak, Basswood, Shagbark Hickory, and Black Cherry.

  • Exoperidium thin, brown and hard with a finely wrinkled surface.

  • Endoperidium thick and gray.

  • Gleba whitish and powdery.

  • Smell: not distinctive from the dirt it was buried in.

  • Microscopy: mounted in Melzer's Reagent.

DNA Barcode ITS:
GCCGGGAACCAAGAAGATCCATTGTTGAAAGTTTTACAACCGATTCTGTGCCCACTCAGACTAGAATTTCACTAACCATCAGTGCTTCAAAAGTCTCCAGCGGGCAAAGGCGCCACAGGGACCATTCGCCCTGCCAGCCAGCCCGCTGAAGCAACAGGGTGATGATTCAGCACGGTGGAGAGATCGGGCCCCCCCGCGGTTGGGGGGAACCCTTACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTT

Observation by thefungiproject
September 7th, 2025 Indian Cave State Park
 (Elaphomyces)

AC62

Hypogeous, found in rodent dig site in upland oak woodland slope. Nearby Trees: Bur Oak, Eastern Red Cedar, Ironwood, Basswood, and Hackberry.

Sarpy Co. Nebraska

Microscopy: hydrated in KOH and mounted in Melzer's reagent.


Observation by thefungiproject
September 11th, 2023 Indian Cave State Park
 (Elaphomyces)

#378

  • Hypogeous, roughly 3-4 cm below moss patches in open mixed oak woodland edge.
  • Parasitized by Tolypocladium ophioglossoides.
  • Nearby Trees: Black Oak, American Hophornbeam, Ash, Northern Red Oak, and Shagbark Hickory.
  • Outer surfaces highly ornamented with tiny polyhedral spines.

Observation by thefungiproject
September 9th, 2025 Indian Cave State Park
 (Elaphomyces)

AC63

Nemaha Co. Nebraska

Hypogeous under Black Oak at the edge of mixed oak woodland. Nearby Trees: Black Oak, Black Cherry, Bur Oak, and Chinkapin Oak.

Smell: not distinctive.

Microscopy: hydrated in KOH and mounted in Melzer's reagent.


Observation by thefungiproject
July 29th, 2025 Indian Cave State Park
 (Elaphomyces)

Richardson Co. Nebraska

AC33

Hypogeous, in mixed oak/hickory woodland, near Missouri River.

Nearby Trees: American Hop Hornbeam, Ash, Northern Red Oak, Bur Oak, Shagbark Hickory, and Basswood.

Smell: not distinctive

Microscopy: hydrated with KOH then mounted in Melzer's reagent.

DNA Barcode ITS:
GCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTTGACTGATCAATTTCTCACCACTCAGACAGCATTCCTGACCACAGTAGCGTTTCGAGGGAGATCTCCGACGGACACGGGCCCGGGGGCAGCGCTCGCGCGAGCCCCCCGGCGGCCAACCATGGCGGGCCCGCCGAAGCAACACGGTACAATCGACAAGGGTGGGAGGTCTGGGCCCCCAACCCCCCGGGAAGGGGGCGGGGACCCGCGCTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTT

Observation by thefungiproject
December 4th, 2025 Indian Cave State Park
 (Elaphomyces)

Collected With No Number.

Richardson Co. Nebraska

Hypogeous, roughly 4-5 cm down in rodent dog site, in upland mixed oak/hickory woodland.

Microscopy: spores mounted in Melzer's reagent. Outer peridium rehydrated in ammonia and mounted in Congo Red.


Observation by thefungiproject
February 16th, 2026 Indian Cave State Park
 (Elaphomyces)

AE67

Richardson Co. Nebraska

Dirt easily removed from outer peridium, unlike many others species.

Microscopy: mounted in Melzer's reagent.

UV: peridium light green under 365nm.


Observation by thefungiproject
February 16th, 2026 Indian Cave State Park
 (Elaphomyces)

Richardson Co. Nebraska

Collected With No Number.

Hypogeous in upland mixed oak/hickory woodland.

Nearby Trees: Black Oak, Bitternut Hickory, and Chinkapin Oak.

Dirt easily removed from outer peridium, unlike many others species.

Specimen enveloped in similar colored mycelium.

No smell evident in the field.

Microscopy: mounted in Melzer's reagent.

UV: peridium light green under 365nm.


Observation by thefungiproject
January 6th, 2026 Indian Cave State Park
 (Elaphomyces)

Collected With No Number.

Nemaha Co. Nebraska

Hypogeous in upland mixed oak/hickory woodland slope. Nearby Trees: Black Oak, Shagbark Hickory, Black Walnut, Bitternut Hickory, Pawpaw, American Hop Hornbeam, Northern Red Oak, and Elm.

UV: endoperidium light green under 365nm light.

Microscopy: first series of shots mounted in Melzer's reagent and last 4 shots mounted in Congo Red.


Observation by thefungiproject

Created February 21, 2026 at 10:41 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.