Elaphomyces sp.
Life > Fungi > Ascomycota > Pezizomycotina > Eurotiomycetes > Eurotiomycetidae > Elaphomycetales > Elaphomycetaceae > Elaphomyces
Observations
August 31st, 2023 Indian Cave State Park

#354
- Hypogeous in mixed oak/hickory woodland ridge.
- Nearby Trees: Shagbark Hickory, Chinkapin Oak, Ash, American Hophornbeam, Black Oak, and Black Walnut.
- Peridium gray and fairly thick.
- Interior laden with powdery light colored spores.
- Smell: slightly foul.
- Taste: not distinctive
- Microscopy: mounted in Melzer's.
GAACGCACATTGCGCCCTTTGGTATTCCAGAGGGCATGCCTGTCCGAGTGTCATCGCCTCCCTTCCAAGCTCAGCTTGGGTGTTGGGCTGTCATCCCTGGCCCCCTTAGGGGTTTGGGATGGGCCTGAAAGGCAGCGGCGGTGTGGTGCTTAGCCTTTGAGTGGATGGGCTGTTTCCCCGCTCCCATAGGCTTGGCTACCTTGGCACCGGCTTTCCCCCCTTCTTTGGAGTCGTTCTTGTTGACTCCATCCAGTAGGCCTCGGATCAGGTAAGGATACCCGCTGAACTTAAView MycoMap DNA Results
August 31st, 2023 Indian Cave State Park

#355
- Hypogeous in open mixed oak/hickory woodland ridge.
- Nearby Trees: Shagbark Hickory, Chinkapin Oak, Ash, American Hophornbeam, Black Oak, and Black Walnut.
- Exoperidium thin and tan.
- Interior powdery and black with whitish inner fibrous material.
- Smell: foul
- Microscopy: mounted in Melzer's. Spores ornamented in dense layer of curled spines. (Reminiscent of Scleroderma)
September 11th, 2023 Indian Cave State Park

#378
- Hypogeous, roughly 3-4 cm below moss patches in open mixed oak woodland edge.
- Parasitized by Tolypocladium ophioglossoides.
- Nearby Trees: Black Oak, American Hophornbeam, Ash, Northern Red Oak, and Shagbark Hickory.
- Outer surfaces highly ornamented with tiny polyhedral spines.
February 27th, 2025 Indian Cave State Park

AA89
Hypogeous, roughly 3-4 cm deep in the side wall of a rodent dig site, in upland mixed oak/hickory woodland.
-
Nearby Trees: Black Oak, Chinkapin Oak, Basswood, Shagbark Hickory, and Black Cherry.
-
Exoperidium thin, brown and hard with a finely wrinkled surface.
-
Endoperidium thick and gray.
-
Gleba whitish and powdery.
-
Smell: not distinctive from the dirt it was buried in.
-
Microscopy: mounted in Melzer's Reagent.
GCCGGGAACCAAGAAGATCCATTGTTGAAAGTTTTACAACCGATTCTGTGCCCACTCAGACTAGAATTTCACTAACCATCAGTGCTTCAAAAGTCTCCAGCGGGCAAAGGCGCCACAGGGACCATTCGCCCTGCCAGCCAGCCCGCTGAAGCAACAGGGTGATGATTCAGCACGGTGGAGAGATCGGGCCCCCCCGCGGTTGGGGGGAACCCTTACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTT
July 29th, 2025 Indian Cave State Park

Richardson Co. Nebraska
AC33
Hypogeous, in mixed oak/hickory woodland, near Missouri River.
Nearby Trees: American Hop Hornbeam, Ash, Northern Red Oak, Bur Oak, Shagbark Hickory, and Basswood.
Smell: not distinctive
Microscopy: hydrated with KOH then mounted in Melzer's reagent.
GCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTTGACTGATCAATTTCTCACCACTCAGACAGCATTCCTGACCACAGTAGCGTTTCGAGGGAGATCTCCGACGGACACGGGCCCGGGGGCAGCGCTCGCGCGAGCCCCCCGGCGGCCAACCATGGCGGGCCCGCCGAAGCAACACGGTACAATCGACAAGGGTGGGAGGTCTGGGCCCCCAACCCCCCGGGAAGGGGGCGGGGACCCGCGCTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTT
September 7th, 2025 Indian Cave State Park

AC62
Hypogeous, found in rodent dig site in upland oak woodland slope. Nearby Trees: Bur Oak, Eastern Red Cedar, Ironwood, Basswood, and Hackberry.
Sarpy Co. Nebraska
Microscopy: hydrated in KOH and mounted in Melzer's reagent.
September 9th, 2025 Indian Cave State Park

AC63
Nemaha Co. Nebraska
Hypogeous under Black Oak at the edge of mixed oak woodland. Nearby Trees: Black Oak, Black Cherry, Bur Oak, and Chinkapin Oak.
Smell: not distinctive.
Microscopy: hydrated in KOH and mounted in Melzer's reagent.
December 4th, 2025 Indian Cave State Park

Collected With No Number.
Richardson Co. Nebraska
Hypogeous, roughly 4-5 cm down in rodent dog site, in upland mixed oak/hickory woodland.
Microscopy: spores mounted in Melzer's reagent. Outer peridium rehydrated in ammonia and mounted in Congo Red.
January 6th, 2026 Indian Cave State Park

Collected With No Number.
Nemaha Co. Nebraska
Hypogeous in upland mixed oak/hickory woodland slope. Nearby Trees: Black Oak, Shagbark Hickory, Black Walnut, Bitternut Hickory, Pawpaw, American Hop Hornbeam, Northern Red Oak, and Elm.
UV: endoperidium light green under 365nm light.
Microscopy: first series of shots mounted in Melzer's reagent and last 4 shots mounted in Congo Red.
February 16th, 2026 Indian Cave State Park

AE67
Richardson Co. Nebraska
Dirt easily removed from outer peridium, unlike many others species.
Microscopy: mounted in Melzer's reagent.
UV: peridium light green under 365nm.
February 16th, 2026 Indian Cave State Park

Richardson Co. Nebraska
Collected With No Number.
Hypogeous in upland mixed oak/hickory woodland.
Nearby Trees: Black Oak, Bitternut Hickory, and Chinkapin Oak.
Dirt easily removed from outer peridium, unlike many others species.
Specimen enveloped in similar colored mycelium.
No smell evident in the field.
Microscopy: mounted in Melzer's reagent.
UV: peridium light green under 365nm.
Created March 17, 2026 at 9:26 PM









































































































































