undefined (Donkia pulcherrima)
undefined (Donkia pulcherrima)
undefined (Donkia pulcherrima)
undefined (Donkia pulcherrima)
undefined (Donkia pulcherrima)
undefined (Donkia pulcherrima)
undefined (Donkia pulcherrima)
undefined (Donkia pulcherrima)
< Back to Home

Donkia pulcherrima

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Polyporales > Phanerochaetaceae > Donkia


Description

Donkia pulcherrima appears in summer and early fall on decaying logs of broadleaf trees, often in shaded, moist forests. It grows in small clusters or alone. The species name means "most beautiful," a reference to its striking appearance. The genus Donkia was named in honor of mycologist Marinus Anton Donk.

Fruiting bodies are semicircular to fan-shaped, with caps that are dull yellow to orangish yellow, often fading to whitish or tan with age. The cap surface features a woolly texture. The underside bears densely packed spines. Flesh is tough and corky, becoming spongy when wet. There is typically no stem, or only a short lateral stub. The spore print is white.


Observations

July 17th, 2023 Indian Cave State Park
 (Donkia pulcherrima)

#215

  • Growing gregariously down Black Oak log in open mixed oak/hickory woodland.
  • Cap tough, spongy, saturated by recent rains, consisting of matted down tufts of hair. Orange colors closer to base.
  • Hymenium adorned with layers of crowded teeth.

Smell: fruity KOH: Reddish on top of cap.

DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAGTTTTGAAATGGGTTGTAAGCTGGCCTCCAAAAACTGAAGGCATGTGCACACCCTGCTCATCCACTCTTCAACCTCTGTGCACTTATTGTAGGAAGGTCGAAAAGTTGAGCTTCGCTGTTTAATCGCGGCTTGAGGTTCCTTCGAAGCCTTCTTATGTTTTATTTTACAAACACTTCAGTTATAGAATGTCAATTTGCGAATAACGCAATACAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCACGCCTGTTTGAGTGTCATGGTATTCTCAACCTTCATAATTTTTGTTTTCAAAAGTTATTGAAGGCTTGGACTTGGAGGTTTGTGCTGGCTCTCTTAATTGAAGTCGGCTCCTCTTAAATGTATTAGCGTGAACGTTTACGGATCGCTATCAGTGTGATAATTATCTGCGCTGTTAGTGTTGAAGTATCATTTGGTGTCTCGCTTCTAACCGTCCTTTTGCAAGGACAAAATTTACTTTGACATCTGACCTCAAATCAGGCGGGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject

References

CLIMACODON PULCHERRIMUS (Bark. & Curt.) Nikol. -Figs. 197-206 - https://www.mycobank.org/details/26/1441

DONKIA PULCHERRIMA (Berk. & M. A. Curtis) Pilat - https://www.mycobank.org/details/26/1643

Kuo, M. (2010, May). Climacodon pulcherrimus. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/climacodon_pulcherrimus.html

Leacock, P.R. (2019 Jan 01). Donkia pulcherrima - MycoGuide. Retrieved from https://www.mycoguide.com/guide/fungi/basi/agar/poly/phan/donk/pulcherrimus


Created March 17, 2026 at 9:26 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.